ID: 1150431393

View in Genome Browser
Species Human (GRCh38)
Location 17:65120794-65120816
Sequence ACTCTGTAGGGCCAAAACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150431393_1150431399 11 Left 1150431393 17:65120794-65120816 CCAGCGTTTTGGCCCTACAGAGT No data
Right 1150431399 17:65120828-65120850 TACTGGAAGAAGACAGTCCAAGG No data
1150431393_1150431398 -6 Left 1150431393 17:65120794-65120816 CCAGCGTTTTGGCCCTACAGAGT No data
Right 1150431398 17:65120811-65120833 CAGAGTGAAGGACAGGATACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150431393 Original CRISPR ACTCTGTAGGGCCAAAACGC TGG (reversed) Intergenic