ID: 1150431393 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:65120794-65120816 |
| Sequence | ACTCTGTAGGGCCAAAACGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1150431393_1150431399 | 11 | Left | 1150431393 | 17:65120794-65120816 | CCAGCGTTTTGGCCCTACAGAGT | No data | ||
| Right | 1150431399 | 17:65120828-65120850 | TACTGGAAGAAGACAGTCCAAGG | No data | ||||
| 1150431393_1150431398 | -6 | Left | 1150431393 | 17:65120794-65120816 | CCAGCGTTTTGGCCCTACAGAGT | No data | ||
| Right | 1150431398 | 17:65120811-65120833 | CAGAGTGAAGGACAGGATACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1150431393 | Original CRISPR | ACTCTGTAGGGCCAAAACGC TGG (reversed) | Intergenic | ||