ID: 1150431925

View in Genome Browser
Species Human (GRCh38)
Location 17:65125286-65125308
Sequence TGCGGGGTGGTCTTTCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150431925_1150431932 28 Left 1150431925 17:65125286-65125308 CCTTCAGGAAAGACCACCCCGCA No data
Right 1150431932 17:65125337-65125359 ACATAAAATGCAAAGTGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150431925 Original CRISPR TGCGGGGTGGTCTTTCCTGA AGG (reversed) Intergenic
No off target data available for this crispr