ID: 1150431927 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 17:65125299-65125321 |
| Sequence | TGAATATTGGCCATGCGGGG TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1150431927_1150431932 | 15 | Left | 1150431927 | 17:65125299-65125321 | CCACCCCGCATGGCCAATATTCA | No data | ||
| Right | 1150431932 | 17:65125337-65125359 | ACATAAAATGCAAAGTGTAGAGG | No data | ||||
| 1150431927_1150431933 | 18 | Left | 1150431927 | 17:65125299-65125321 | CCACCCCGCATGGCCAATATTCA | No data | ||
| Right | 1150431933 | 17:65125340-65125362 | TAAAATGCAAAGTGTAGAGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1150431927 | Original CRISPR | TGAATATTGGCCATGCGGGG TGG (reversed) | Intergenic | ||