ID: 1150431928

View in Genome Browser
Species Human (GRCh38)
Location 17:65125302-65125324
Sequence ACATGAATATTGGCCATGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150431928_1150431932 12 Left 1150431928 17:65125302-65125324 CCCCGCATGGCCAATATTCATGT No data
Right 1150431932 17:65125337-65125359 ACATAAAATGCAAAGTGTAGAGG No data
1150431928_1150431933 15 Left 1150431928 17:65125302-65125324 CCCCGCATGGCCAATATTCATGT No data
Right 1150431933 17:65125340-65125362 TAAAATGCAAAGTGTAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150431928 Original CRISPR ACATGAATATTGGCCATGCG GGG (reversed) Intergenic