ID: 1150431931

View in Genome Browser
Species Human (GRCh38)
Location 17:65125312-65125334
Sequence GAATTTTTGCACATGAATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150431931_1150431934 27 Left 1150431931 17:65125312-65125334 CCAATATTCATGTGCAAAAATTC No data
Right 1150431934 17:65125362-65125384 GCTTTAAGATACAGTAAACAAGG No data
1150431931_1150431932 2 Left 1150431931 17:65125312-65125334 CCAATATTCATGTGCAAAAATTC No data
Right 1150431932 17:65125337-65125359 ACATAAAATGCAAAGTGTAGAGG No data
1150431931_1150431933 5 Left 1150431931 17:65125312-65125334 CCAATATTCATGTGCAAAAATTC No data
Right 1150431933 17:65125340-65125362 TAAAATGCAAAGTGTAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150431931 Original CRISPR GAATTTTTGCACATGAATAT TGG (reversed) Intergenic