ID: 1150431932

View in Genome Browser
Species Human (GRCh38)
Location 17:65125337-65125359
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150431931_1150431932 2 Left 1150431931 17:65125312-65125334 CCAATATTCATGTGCAAAAATTC No data
Right 1150431932 17:65125337-65125359 ACATAAAATGCAAAGTGTAGAGG No data
1150431928_1150431932 12 Left 1150431928 17:65125302-65125324 CCCCGCATGGCCAATATTCATGT No data
Right 1150431932 17:65125337-65125359 ACATAAAATGCAAAGTGTAGAGG No data
1150431925_1150431932 28 Left 1150431925 17:65125286-65125308 CCTTCAGGAAAGACCACCCCGCA No data
Right 1150431932 17:65125337-65125359 ACATAAAATGCAAAGTGTAGAGG No data
1150431929_1150431932 11 Left 1150431929 17:65125303-65125325 CCCGCATGGCCAATATTCATGTG No data
Right 1150431932 17:65125337-65125359 ACATAAAATGCAAAGTGTAGAGG No data
1150431930_1150431932 10 Left 1150431930 17:65125304-65125326 CCGCATGGCCAATATTCATGTGC No data
Right 1150431932 17:65125337-65125359 ACATAAAATGCAAAGTGTAGAGG No data
1150431927_1150431932 15 Left 1150431927 17:65125299-65125321 CCACCCCGCATGGCCAATATTCA No data
Right 1150431932 17:65125337-65125359 ACATAAAATGCAAAGTGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150431932 Original CRISPR ACATAAAATGCAAAGTGTAG AGG Intergenic