ID: 1150435594

View in Genome Browser
Species Human (GRCh38)
Location 17:65151936-65151958
Sequence TTTCTGTTGTTGTTTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 795
Summary {0: 1, 1: 1, 2: 6, 3: 57, 4: 730}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150435594_1150435603 16 Left 1150435594 17:65151936-65151958 CCAGCAGCAAACAACAACAGAAA 0: 1
1: 1
2: 6
3: 57
4: 730
Right 1150435603 17:65151975-65151997 GCTTGCTTTCCAGGAGCTAGGGG 0: 1
1: 0
2: 2
3: 24
4: 243
1150435594_1150435602 15 Left 1150435594 17:65151936-65151958 CCAGCAGCAAACAACAACAGAAA 0: 1
1: 1
2: 6
3: 57
4: 730
Right 1150435602 17:65151974-65151996 AGCTTGCTTTCCAGGAGCTAGGG 0: 1
1: 0
2: 0
3: 18
4: 160
1150435594_1150435600 7 Left 1150435594 17:65151936-65151958 CCAGCAGCAAACAACAACAGAAA 0: 1
1: 1
2: 6
3: 57
4: 730
Right 1150435600 17:65151966-65151988 CCAGGAAGAGCTTGCTTTCCAGG 0: 1
1: 1
2: 1
3: 27
4: 316
1150435594_1150435601 14 Left 1150435594 17:65151936-65151958 CCAGCAGCAAACAACAACAGAAA 0: 1
1: 1
2: 6
3: 57
4: 730
Right 1150435601 17:65151973-65151995 GAGCTTGCTTTCCAGGAGCTAGG 0: 1
1: 0
2: 0
3: 42
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150435594 Original CRISPR TTTCTGTTGTTGTTTGCTGC TGG (reversed) Intronic
900752825 1:4409705-4409727 TTTCTGATGTGGTATGCTGAAGG + Intergenic
901661615 1:10801542-10801564 TTTTTGTTGTTGTTTGTTTTTGG - Intergenic
901970785 1:12906010-12906032 GTTCTGTTGGAGTTTGCTGGAGG - Intronic
902014380 1:13295760-13295782 GTTCTGTTGGAGTTTGCTGGAGG + Intergenic
902609952 1:17591246-17591268 TTTTTGTTGTTGTTTGAAACAGG + Intronic
903038976 1:20514155-20514177 CTCCCGTTGTTGTCTGCTGCTGG - Intergenic
903210521 1:21815603-21815625 TTTTTGTTGTTGTTTTAGGCAGG - Intronic
904031194 1:27534334-27534356 TTGTTGTTGTTGTTTTCTGTTGG - Exonic
905206921 1:36348085-36348107 ATTCTGTTACTGTTTGCTGAGGG - Intronic
905585497 1:39114128-39114150 TTTCTGTGGTTGTTGGGTGGGGG - Intronic
906571707 1:46847050-46847072 GGTCTGTTGGTGTTTGCTGGAGG - Intergenic
906589156 1:47007330-47007352 GGTCTGTTGGTGTTTGCTGGAGG - Intergenic
907003917 1:50891596-50891618 GGTCTGTTGGTGTTTGCTGGAGG + Intronic
908724458 1:67160303-67160325 TTTCTGTTTTTGTTTTTTGCTGG - Intronic
908977438 1:69915491-69915513 TTTCTTTCTTTGTTTCCTGCAGG - Intronic
908992410 1:70108965-70108987 TTGTTGTTGTTGTTTGGTGGTGG + Intronic
909453997 1:75829688-75829710 GGTCTGTTGGTGTTTGCTGGAGG - Intronic
909570438 1:77104150-77104172 TTTTTGTTGCTGTTAGCTGCTGG - Intronic
909863839 1:80640289-80640311 TTTATTTCCTTGTTTGCTGCAGG - Intergenic
910168040 1:84348576-84348598 TTTTTGTTATTGTTTGCTATGGG - Intronic
910974538 1:92892404-92892426 GTTCTGTTGGAGTTTGCTGGAGG - Intronic
911129825 1:94376686-94376708 TTTCTTTGGTTGTTTCCTTCTGG + Intergenic
912009801 1:104945923-104945945 TTGCTATTGTTATTTGTTGCAGG - Intergenic
912074284 1:105852476-105852498 TTTTAGTTGTTTATTGCTGCAGG - Intergenic
912772731 1:112479617-112479639 TTTGTGATCTTGTTGGCTGCTGG - Intronic
913081155 1:115388570-115388592 GTTCTGTTGGAGTTTGCTGGAGG + Intergenic
913133067 1:115860094-115860116 TTTCTCATGTGGTTTGCTACAGG + Intergenic
913253638 1:116934316-116934338 TTTCTGTTGTTGTTAGAGACAGG + Intronic
913576835 1:120183673-120183695 TTGTTGTTGTTGTTTGCTTGTGG + Intergenic
914458805 1:147862503-147862525 TGTCTGTTGGAGTTTGCTGGAGG - Intergenic
914558744 1:148795108-148795130 TTGCTGTTGTTGTTTGCTTGTGG + Intergenic
914614089 1:149335122-149335144 TTGCTGTTGTTGTTTGCTTGTGG - Intergenic
914728779 1:150352086-150352108 TTTCTGTTGTAATTCTCTGCTGG + Intronic
914886116 1:151585718-151585740 TGTGTGTTGCTGTTTTCTGCAGG + Intergenic
914944499 1:152052033-152052055 TTTCTGTTTTTTTTTTCAGCAGG + Intergenic
915757743 1:158279292-158279314 GGTCTGTTGTAGTTTGCTGGAGG + Intergenic
916232144 1:162550997-162551019 TTTGTGTTTTTGTTGGCTGGAGG + Intergenic
916435890 1:164777415-164777437 TTGTTGTTGTTGTTTGAGGCAGG - Intronic
916469430 1:165108814-165108836 TGTCTGTTGGAGTTTGCTGGAGG + Intergenic
916492442 1:165313882-165313904 TTGTTGTTGTTGTTACCTGCAGG - Intronic
917785708 1:178455339-178455361 TTGATGTTTTTGTTTGCTACAGG + Intronic
918161443 1:181904487-181904509 TTTTTCTTGTTGTTTGAGGCAGG + Intergenic
919353695 1:196494402-196494424 TTTTTGTTGTTTTTTGGTGACGG + Intronic
919490519 1:198199546-198199568 TTGCTTTTTCTGTTTGCTGCTGG + Intronic
919642584 1:200059919-200059941 TTTTTGTTGTTCTTGGCTGTGGG - Intronic
920615386 1:207487290-207487312 TTGCTGTTGTTGTTTGAGACAGG + Intronic
920851188 1:209629007-209629029 TTTCTGTTGATGTTTGTTTCTGG - Intronic
921216703 1:212943897-212943919 TTTTTGTTGTTGTTTTGTGATGG + Intergenic
921266446 1:213424672-213424694 ATTTTGTTGTTGTTTTATGCAGG + Intergenic
922168350 1:223134434-223134456 TTTTTGCTGTTTTTTGATGCTGG - Intronic
922195088 1:223352863-223352885 TTTCTGTTGCTGGATGCTGGAGG - Intronic
923278652 1:232420317-232420339 TTTTTGTTGTTGTTTGGAGACGG - Intronic
923385541 1:233462165-233462187 TTTCTGTTTTTGTTTTCTGCAGG + Intergenic
923879650 1:238089476-238089498 TTTCTGTTATGGTTTGTAGCTGG + Intergenic
924864183 1:247960178-247960200 GTTCTGTTGGAGTTTGCTGGAGG + Intronic
1062766082 10:66323-66345 ATTCTCATGTTGTTTGTTGCTGG - Intergenic
1063204206 10:3815204-3815226 TTGTTGTTGTTGTTTGTTGTTGG + Intergenic
1063505226 10:6591805-6591827 TTTCTGCTGTTATCTGCTGTGGG + Intergenic
1063841191 10:10074554-10074576 GGTCTGTTGGTGTTTGCTGGAGG + Intergenic
1064043582 10:11990390-11990412 TTTCTGATGTTGGTTGCTTTGGG - Intronic
1064081616 10:12312389-12312411 TTTTTGTTTTTGTTTTTTGCGGG - Intergenic
1064708514 10:18097638-18097660 TTTCTGATTTTGTTTGTAGCAGG + Intergenic
1064859162 10:19807066-19807088 TTTTTGTTGTTGTTTTTTGATGG - Intergenic
1064983169 10:21184282-21184304 CTTCTGTTGTTGATTGCCACAGG - Intergenic
1065015252 10:21456930-21456952 TTTCTTTTATTGTTTGAGGCGGG + Intergenic
1065038719 10:21668054-21668076 TTGTTGTTGTTGTTTTCTACTGG - Intronic
1065752877 10:28904216-28904238 TTTCTGTTTTCTTTTTCTGCTGG + Intergenic
1066584101 10:36913276-36913298 GGTCTGTTGGAGTTTGCTGCAGG + Intergenic
1066988581 10:42490483-42490505 TCTCTGTTGTTAATTGCTGAGGG - Intergenic
1067185412 10:44022973-44022995 TGTCTGTTTTAATTTGCTGCAGG + Intergenic
1067295630 10:44973793-44973815 TGTGTGTTGGTGTATGCTGCGGG + Intronic
1067515449 10:46937062-46937084 TTGTTGTTGTTGTTTAGTGCAGG + Intronic
1067561762 10:47309547-47309569 TTGTTGTTGTTGTTTGCTACGGG + Intronic
1067646801 10:48114748-48114770 TTGTTGTTGTTGTTTAGTGCAGG - Intergenic
1067775113 10:49158140-49158162 TTTCTGTTTTTGTGTGTTTCAGG - Intronic
1068010473 10:51443487-51443509 TTTCTATTGTTTTTTTCTTCAGG + Intronic
1068014587 10:51499989-51500011 ATTATGTTTTTGTTTGTTGCTGG - Intronic
1068029674 10:51691210-51691232 TTTTTGTTTTTGTTTGCTTTGGG + Intronic
1068132574 10:52912894-52912916 TTTTTGTTGTTGTGTGTTACTGG - Intergenic
1068475900 10:57524386-57524408 TTTATATTTTTGTTTGTTGCTGG + Intergenic
1068694196 10:59948458-59948480 TTTCTTTTGCTGTTGGCAGCAGG + Intergenic
1068993017 10:63170396-63170418 TTGCTGTTGTTGATTCCTGAGGG + Intronic
1069650403 10:70042965-70042987 TTTCTGATGCTTTTTGCAGCAGG + Intergenic
1069851199 10:71406200-71406222 TTTCTGTTGCTTTTTGCTTTTGG + Intronic
1069992723 10:72325102-72325124 TTTCTGTTGCTGGTGTCTGCAGG - Intergenic
1070061474 10:72987816-72987838 TTTTTGTTGTTGTTTTTTTCTGG + Intergenic
1070487874 10:76948008-76948030 TTTTTGTTTTTGTTTGAGGCAGG + Intronic
1071013792 10:80970711-80970733 TTAGTGTTGTTCTCTGCTGCTGG + Intergenic
1071219390 10:83445953-83445975 CTTATGTGGTTTTTTGCTGCTGG + Intergenic
1071327527 10:84531846-84531868 TTTCTTTTGTTTTTTGCTTTTGG + Intergenic
1071684254 10:87737802-87737824 TTTTTGTTTTTGTTTGAGGCAGG - Intronic
1071868857 10:89769303-89769325 TTTCTGTTTTTGGTTGGGGCAGG + Intronic
1072145592 10:92633601-92633623 TTTCTGTTTTTGTTTGTTATAGG + Exonic
1072381918 10:94881532-94881554 TTTTTCAAGTTGTTTGCTGCTGG + Intergenic
1072859150 10:98984395-98984417 GTTCTGTTGGAGTTTGCTGGAGG - Intronic
1073459805 10:103660125-103660147 TTTCAGTTTCGGTTTGCTGCAGG - Intronic
1073460717 10:103664248-103664270 TCTCTATTCTTGTTTGTTGCTGG - Intronic
1073591726 10:104764090-104764112 TTTCTGTTTTGGCTTGATGCAGG + Intronic
1073681669 10:105711542-105711564 TTTATGGTGTTGTCTTCTGCTGG + Intergenic
1073745958 10:106468106-106468128 GGTCTGTTGGAGTTTGCTGCAGG - Intergenic
1073974250 10:109082561-109082583 TTATTTTTGTTGTTTGCTGCAGG - Intergenic
1074292584 10:112150435-112150457 TTTCTGTGCTTATTTTCTGCAGG + Exonic
1074464910 10:113672304-113672326 TGTCTGTTGGAGTTTGCTGGAGG - Intergenic
1074629681 10:115238523-115238545 TTTTTGTTCTTGTTCACTGCTGG + Intronic
1074645328 10:115444311-115444333 TTTCTTTTGTTTTTTGGTGCAGG + Intronic
1076037868 10:127215836-127215858 TTGCTTTTGTTGTTTTCTGGGGG - Intronic
1076573649 10:131449465-131449487 TTTCTGTTGTTGTTTCCATGTGG + Intergenic
1077092387 11:785261-785283 TTTTTGTTGTTGTTTGAGACAGG + Intergenic
1078032312 11:7765040-7765062 GTTCTGTTGGAGTTTGCTGGAGG - Intergenic
1078274410 11:9829450-9829472 TTTCTCTTGTTCTATGCTACTGG + Exonic
1078383170 11:10862441-10862463 TTTTTGTTGTTGTTTGAGACAGG - Intergenic
1078597540 11:12701383-12701405 TTTGTTTTGTTGTTTGCTACAGG - Intronic
1078841696 11:15082394-15082416 TTTTTGTTGTTGTTTCTTTCAGG + Intergenic
1079259006 11:18859755-18859777 CATCTGTTGTTTTTTGCTGGAGG - Intergenic
1079348460 11:19672931-19672953 TTTGTGTGTTTGTTTGCTCCTGG + Intronic
1079469775 11:20767110-20767132 TGTCTGTTGTTGGTTCCTTCAGG + Intronic
1079587164 11:22140097-22140119 TTTCTGTTGGTGTCTGGTGAGGG - Intergenic
1079845830 11:25466567-25466589 TTTTTGTTCTTATTTGCTTCAGG - Intergenic
1080042814 11:27776941-27776963 TTTGTCTTGTTGTTTGCTATTGG - Intergenic
1080545777 11:33316815-33316837 TTTTTGTTGTTGTTTTGTGATGG - Intronic
1081338149 11:41893584-41893606 TTCTTGTTGCTGTTTGCTTCTGG + Intergenic
1081630878 11:44688736-44688758 TTCCTGCTGTTGTTTGTTCCTGG + Intergenic
1081843872 11:46224287-46224309 TTTTTGTTGTTGTTTGAGACAGG + Intergenic
1082141691 11:48616994-48617016 TGTCTGTTGGAGTTTGCTGGAGG + Intergenic
1082269065 11:50149729-50149751 GGTCTGTTGGTGTTTGCTGGAGG - Intergenic
1083156657 11:60827509-60827531 TTTCTGTACTTTTTTGCTGATGG + Intergenic
1083809213 11:65093941-65093963 TTTTTGTTGTTGTTTGTTTGGGG + Intronic
1085372355 11:76020659-76020681 TTTTTTTTTTTTTTTGCTGCAGG + Intronic
1085557020 11:77433302-77433324 CTTCTTTTGTTGTTTGCTTTTGG - Intronic
1085566766 11:77521152-77521174 TTTCTGTTATTGTCTGCCTCTGG + Intronic
1085964612 11:81506933-81506955 TTTCTGTTATTTATAGCTGCTGG + Intergenic
1086830918 11:91562388-91562410 TTTATGCTGTTGTCTGCTACTGG - Intergenic
1087480208 11:98691372-98691394 TTCTTGTTGTTGTTTGAAGCTGG + Intergenic
1087824984 11:102754904-102754926 TTTTTTTTTTTTTTTGCTGCTGG - Intergenic
1087898357 11:103612208-103612230 GTTCTGTTGGAGTTTGCTGGAGG - Intergenic
1088629420 11:111760257-111760279 TTTTTGTTGTTGTTTGTCGGGGG + Intronic
1090289971 11:125534596-125534618 TTTTTGTAGTTGTTTCCTGTAGG + Intergenic
1090915184 11:131156791-131156813 TTTCTGTTGTTTGATGATGCCGG + Intergenic
1091171433 11:133523060-133523082 TGTCTGTGGTTGTTTCCTCCTGG - Intronic
1091726507 12:2850036-2850058 TTGCTGTTGTTGGTTTATGCAGG + Intronic
1091772545 12:3162465-3162487 TCTCTGCTGTTGGTTCCTGCAGG - Intronic
1092278036 12:7077039-7077061 TCTTTGTTGTTGTTTGGTTCAGG + Intergenic
1092368660 12:7898243-7898265 TTTCTGTCATTTTTTCCTGCAGG + Intergenic
1092439105 12:8482261-8482283 GGTCTGTTGGTGTTTGCTGGAGG + Intergenic
1092582652 12:9862653-9862675 ATTTTGTTGTTGTTTTCTGTGGG - Intronic
1093648443 12:21616226-21616248 TTTTTGTTTTTGTTTTCTGATGG + Intergenic
1093651983 12:21657038-21657060 GATCTGCTGTTCTTTGCTGCCGG - Intronic
1093841665 12:23909947-23909969 TGTTTTTTGTTTTTTGCTGCTGG + Intronic
1094177519 12:27556613-27556635 TTTCCATTGTGCTTTGCTGCTGG + Intronic
1095134080 12:38576752-38576774 TTTCTGTTCTTTTTTGATGAAGG - Intergenic
1095146081 12:38728147-38728169 TTTTTGTTGTTGTTGAATGCTGG - Intronic
1095164552 12:38956421-38956443 TTTGTGTAGGTCTTTGCTGCTGG + Intergenic
1095191323 12:39261305-39261327 TGTCTGTTGGAGTTTGCTGGAGG - Intergenic
1095380603 12:41586391-41586413 TTTCTCTTGTTGTTTGCTGTTGG + Intergenic
1095468698 12:42513994-42514016 TTTTTGTTGTTGTTTTTTGGAGG - Intronic
1095584451 12:43835581-43835603 TTTCTGTTTTTGTCTGTTGGTGG - Intergenic
1095652044 12:44622860-44622882 TTTATCTTGTATTTTGCTGCAGG - Intronic
1095773928 12:45991554-45991576 TTTTTGTTGTTGTTTGAGACAGG - Intronic
1095832496 12:46602806-46602828 TTTCTGTAGTTCTTTGTTCCTGG + Intergenic
1095845338 12:46737851-46737873 GTTCTGTTGGAGTTTGCTGGAGG - Intergenic
1096238508 12:49945840-49945862 ATTAGGGTGTTGTTTGCTGCTGG - Intergenic
1096675200 12:53222346-53222368 TTTTTGTTGTTGTTTGCTGCTGG - Intronic
1098439269 12:70500824-70500846 TTGATGTTGTTGTTTGATACAGG - Intergenic
1098692204 12:73503269-73503291 TGTCTGTTGGAGTTTGCTGGAGG + Intergenic
1099053365 12:77808441-77808463 TGTCTGCTGTAGTTTGCTGGAGG + Intergenic
1099720621 12:86357224-86357246 GTTCTGTTGGAGTTTGCTGGAGG - Intronic
1100044680 12:90365059-90365081 TTGTTTTTGTTGTTTGTTGCAGG + Intergenic
1100209751 12:92388708-92388730 TTTCTTTTCTTGTTTCCTTCTGG - Intergenic
1100304194 12:93335593-93335615 TTTTTGTTGTTGTTTGAGACAGG - Intergenic
1100530269 12:95455881-95455903 TTTCTTTGGTTGTTTCCTTCTGG + Intergenic
1100652297 12:96604219-96604241 GTTCTGTTGGAGTTTGCTGGAGG + Intronic
1100904954 12:99286740-99286762 TTACTGCTGATGTTTGCTCCAGG - Intronic
1100981100 12:100163243-100163265 TTTTTTTTTTTTTTTGCTGCAGG + Intergenic
1100996175 12:100303525-100303547 TGTCTGTTGGAGTTTGCTGGAGG + Intronic
1101619610 12:106372276-106372298 TTTCTGTTATTTTTTTCTGGGGG + Intronic
1101623301 12:106412270-106412292 TTTCAGCTGATGTTTGCTGCAGG - Intronic
1101831424 12:108260292-108260314 TTACTGTTGTTGATTGTTGGAGG - Intergenic
1102123485 12:110461795-110461817 TATCTGTTATTGATTGCTGAGGG - Intronic
1102196950 12:111033209-111033231 TTTCTGTTGTTATTATCTGGGGG - Intergenic
1103081983 12:118031443-118031465 TTTTTGTGGTTGTTTGGAGCAGG + Exonic
1104111439 12:125708776-125708798 TTTCTGTTGCTTTCTGCAGCCGG + Intergenic
1104147768 12:126052257-126052279 TTTTTGTTTTTGTTTGGTGGGGG - Intergenic
1105559216 13:21474690-21474712 TTTTTCTTTTTCTTTGCTGCAGG + Intergenic
1105630846 13:22165777-22165799 TTGCTTTTGTTGTTTGATGAAGG + Intergenic
1105761574 13:23520256-23520278 TTTCTGTCCTTGCTTCCTGCTGG - Intergenic
1106445690 13:29828913-29828935 GGTCTGTTGTAGTTTGCTGGAGG + Intronic
1106737326 13:32600857-32600879 TTTTAGTTGTTGTTTTCTTCTGG + Intronic
1106797786 13:33224773-33224795 TTGCTGATGTTGTTTTCTGAAGG - Intronic
1107084290 13:36409024-36409046 ATTTTGTTGTTATTTGCTGCTGG - Intergenic
1107720236 13:43240820-43240842 TCTCTGGTTTTGTTTGCAGCAGG + Intronic
1107997504 13:45875183-45875205 TCTCTGTTGATGTGTGCAGCTGG + Intergenic
1108900606 13:55402491-55402513 ATTCCTTTGCTGTTTGCTGCTGG + Intergenic
1109164524 13:59017268-59017290 TTTCAGATTTTGTTTGCTGTGGG - Intergenic
1109368974 13:61396861-61396883 ATTCTGTTTTTGTTTACTTCAGG + Intergenic
1109476326 13:62883955-62883977 TTTTTTGTGTTGTTTGCTGTTGG - Intergenic
1110006279 13:70275223-70275245 TTTCTCTTCTTGATTGCTTCCGG + Intergenic
1110429028 13:75401720-75401742 TTCTTGTTGTTGTTAGCTACTGG + Intronic
1110699216 13:78526939-78526961 TGTCTGTTGGAGTTTGCTGGTGG - Intergenic
1111327789 13:86721975-86721997 TTTCTGGGGATGTTTTCTGCAGG + Intergenic
1111603716 13:90508271-90508293 TTTCTATTTTTGTTGGATGCAGG - Intergenic
1113445886 13:110366503-110366525 TTACTGTTGTTGTTTTCTTCTGG + Intronic
1114143114 14:19939959-19939981 TTTTTGTTGTTGTTTGTTAAAGG - Intergenic
1114579435 14:23744163-23744185 GTTCTGTTGGAGTTTGCTGGAGG + Intergenic
1114647226 14:24262572-24262594 TTTCGGATGTTGTTTGGTGGGGG - Intronic
1114923402 14:27362756-27362778 GGTCTGTTGGAGTTTGCTGCAGG + Intergenic
1114958286 14:27849897-27849919 TTGTTGTTGTTGTTTTCTGTTGG - Intergenic
1116066829 14:39995224-39995246 ATTCTGTTGTTTTTGGCTGAAGG + Intergenic
1116077946 14:40135918-40135940 TTTGCTTTTTTGTTTGCTGCTGG + Intergenic
1116236406 14:42284889-42284911 GTTCTGTTGGAGTTTGCTGGAGG + Intergenic
1116482851 14:45412278-45412300 TGTCTGTTGGAGTTTGCTGGAGG - Intergenic
1116585491 14:46697849-46697871 TCTCTGTTGTAGTTTGCTATGGG + Intergenic
1116718736 14:48464357-48464379 TTTCTGTTACTGTCTCCTGCCGG - Intergenic
1116727908 14:48585918-48585940 TTGTTGTTGTTGTTTGCTTTTGG - Intergenic
1116783282 14:49260337-49260359 TTTCTGTTACAGTTTGATGCAGG - Intergenic
1117784068 14:59264456-59264478 TTTCTGTTCCTGTTTTCTGAAGG + Intronic
1117909118 14:60619603-60619625 TTTTTGTTGTTGTTTGAGACAGG + Intergenic
1117952523 14:61097505-61097527 TGTCTGTTGGAGTTTGCTGGAGG + Intergenic
1118067072 14:62204345-62204367 TGTCTGTTGGAGTTTGCTGGAGG + Intergenic
1118506383 14:66417197-66417219 TTTCTGTTTTTTTTTTCTACTGG - Intergenic
1119065274 14:71519291-71519313 TTTTTGTTTTTGTTTGAGGCAGG - Intronic
1119207350 14:72804414-72804436 TTTTTGTTGTTGTTTGCTCCTGG - Intronic
1119306800 14:73614193-73614215 TTGTTGTTGTTGTTTGAGGCAGG - Intronic
1120488961 14:85152117-85152139 TTTCTTTTTTTTTTGGCTGCGGG - Intergenic
1120743168 14:88130103-88130125 TTTCTTTGGTTGTGTGCTGGTGG - Intergenic
1120760264 14:88278588-88278610 TTTCTCTTGTGTTTTCCTGCAGG - Intronic
1121121538 14:91378918-91378940 TTTCTGTTATTGTGTGCAGAAGG + Intronic
1122001158 14:98655275-98655297 ATTCTATAGTTGTTTGCTGTGGG - Intergenic
1122833617 14:104419954-104419976 TTTCTGTTTCTGTTTGCTTTTGG - Intergenic
1123966266 15:25462321-25462343 ATTTTCTAGTTGTTTGCTGCTGG - Intergenic
1124111458 15:26793889-26793911 TTTCTGTTGCTGTTTGCATAAGG - Intronic
1124203339 15:27697114-27697136 TCTGTGTTGTTGGGTGCTGCAGG - Intergenic
1124916540 15:33980478-33980500 TTTCTCTTGTTGTGGGCTGATGG + Intronic
1126466861 15:48968697-48968719 TTTCTGTTGCTTCTAGCTGCTGG - Intergenic
1126725757 15:51629967-51629989 TTTTTGTTGTTGTGTGGTGGTGG + Intergenic
1127236959 15:57064359-57064381 TTTTTGTTTTTGTTTTTTGCTGG - Intronic
1128518171 15:68356894-68356916 TGTCAGTTGTTGTTGGCTGTTGG - Intronic
1128964164 15:72040760-72040782 TTTATTTTTTTGTTTCCTGCTGG - Intronic
1130433871 15:83876601-83876623 TTTTTGTTGTTGTTTGTTTGTGG + Intronic
1130626281 15:85518821-85518843 TTTTTGTTGTTGTTTGAGACAGG - Intronic
1131924808 15:97370904-97370926 TTTCTGTTGCTTTGTGCTACAGG + Intergenic
1134043119 16:11083166-11083188 TGTTTGTTGTTGTTTGAGGCAGG + Intronic
1134320596 16:13159078-13159100 TTTCTTTTGTTGTTTGTTTTTGG - Intronic
1135422000 16:22311478-22311500 TTTTTGTTGTTGTTTGTTTTGGG + Intronic
1135565162 16:23506363-23506385 TATTTGTTGTTGTTTTCTTCTGG - Intronic
1136078366 16:27832810-27832832 GTTTTGTTGTTGTTTACTGTTGG + Intronic
1136407352 16:30055803-30055825 TTTTTGTTGTTGTTTGAGACAGG + Intronic
1136496224 16:30646476-30646498 TTGCTGTTGTTGTTTGACACAGG - Intergenic
1136604299 16:31322501-31322523 TTTCAGTTGCTGTTTTCTACTGG - Intronic
1137437184 16:48465460-48465482 GGTCTGTTGGTGTTTGCTGGAGG + Intergenic
1137632251 16:49955155-49955177 TTTTTGTTTTTGTTCTCTGCAGG - Intergenic
1137690118 16:50420347-50420369 TTGCTGTTGTTGATTGCGGATGG + Intergenic
1137795215 16:51211558-51211580 TTTCTGTTTTTGTTTTCTTTGGG + Intergenic
1137806660 16:51312925-51312947 TTTCTGTTTTTGTTGGCAGATGG + Intergenic
1139213281 16:65101956-65101978 TTTTTGTTGTTGTTTGTTTCAGG + Intronic
1139429027 16:66901204-66901226 GTTCTCTTGCTGTTTGCTGTGGG - Intergenic
1139941814 16:70610977-70610999 TTTTTGTTGTTGTTTGAGACAGG + Intronic
1140055082 16:71518943-71518965 TTGTTGTTGTTGTTTTCAGCTGG + Intronic
1140093297 16:71854355-71854377 TTTCTGTTGCTGTCTCTTGCTGG + Exonic
1140770408 16:78198514-78198536 TTTCTCTGGATGTTGGCTGCAGG + Intronic
1140806825 16:78540221-78540243 TTTCTGTTGCTCCTTGCTGCAGG - Intronic
1141281614 16:82634305-82634327 TTTCTTGTGTTGTGTGCTGCAGG + Intronic
1142308089 16:89296829-89296851 TTTGTGCTGTTTTATGCTGCTGG - Intronic
1142329091 16:89438984-89439006 TTTCTGTTTTTGTTTGAGGCAGG - Intronic
1142708760 17:1712145-1712167 TTTCTGTTATGGTTTGCTAAGGG + Intergenic
1143422665 17:6807706-6807728 GTTCTGTTGGAGTTTGCTGGAGG + Intronic
1144356074 17:14447771-14447793 TTTCTGCTGTTTTCTTCTGCGGG - Intergenic
1146617257 17:34366814-34366836 TTTCTGTGGTTGTATGTTGCTGG - Intergenic
1146838389 17:36131296-36131318 TTTTTTTTTTTTTTTGCTGCTGG - Intergenic
1146965492 17:37025213-37025235 TTTTTGTTGTTGTTTTTTGAGGG + Intronic
1147355159 17:39889838-39889860 TTTTTGTTGTTGTTGGGTGGGGG + Intergenic
1147771326 17:42869804-42869826 TTTTTGTTGTTGTTTGAAACAGG + Intergenic
1148113798 17:45162728-45162750 TTTCTGTTGTTGTTCAAAGCAGG + Exonic
1148762136 17:50010716-50010738 TTGCTGTTGTTGCTTACTGCAGG + Intergenic
1149133823 17:53340754-53340776 GGTCTGTTGGTGTTTGCTGGAGG - Intergenic
1149876892 17:60243798-60243820 ATTCTGTTGCTGTTGGCTGAAGG + Intronic
1149955795 17:61048266-61048288 TTTCTGTTGTTGCTACATGCAGG - Intronic
1150361565 17:64539560-64539582 TTTCTCTTGTTGTTTATTCCTGG - Intronic
1150435594 17:65151936-65151958 TTTCTGTTGTTGTTTGCTGCTGG - Intronic
1151195349 17:72427335-72427357 TTTTTTTTTTTTTTTGCTGCTGG + Intergenic
1151291157 17:73151094-73151116 TTCCTGTGGTTGTTGGCTGGAGG + Intergenic
1151902939 17:77029207-77029229 TTTCTGTTGTTGTTTTAGACAGG + Intergenic
1151947681 17:77328369-77328391 TTGTTGTTGTTGTTTGATACGGG + Intronic
1153052349 18:910879-910901 TTTTTTTTTTTGTTTGATGCAGG + Exonic
1153258775 18:3200162-3200184 TTTTTGTTTTTGTTTTCAGCTGG - Intronic
1153386043 18:4498039-4498061 TTTGTGTTTTATTTTGCTGCTGG - Intergenic
1153736888 18:8080447-8080469 TTTCTATAGTTGGTTGCTGATGG - Intronic
1153755902 18:8282655-8282677 TTGCTGTTGTTTTTTGCGACAGG - Intronic
1153762301 18:8343401-8343423 TTTCTGTTGTGTTTTGCTGCAGG + Exonic
1154101445 18:11478714-11478736 TGTCTGCTGTAGTTTGCTGGAGG + Intergenic
1154120714 18:11650155-11650177 TGGCTGTTGTTGCTGGCTGCTGG - Intergenic
1154444903 18:14428175-14428197 TGTCTGTTGGGGTTTGCTGGAGG + Intergenic
1155325180 18:24657634-24657656 TTCCTGCTGTTGTTTCCTCCAGG + Intergenic
1155854734 18:30818855-30818877 TTTCTGTTGTTTTTTTCACCAGG - Intergenic
1155915727 18:31555193-31555215 TTTCTTTTGTTGGTTGATACTGG - Intergenic
1156099050 18:33571883-33571905 TTTCTATTGTTTTTTACTGGAGG - Intergenic
1156179986 18:34591984-34592006 TTTCTGTTTTTGTTTGTTGATGG - Intronic
1156419126 18:36931758-36931780 TTTTTGTTGTTTTTTGCTTTAGG + Intronic
1156870516 18:41940051-41940073 TTTTTGTTTTTGTTTTCTTCTGG - Intergenic
1157036823 18:43984891-43984913 GTTCTGTTGGAGTTTGCTGGAGG - Intergenic
1157904490 18:51557192-51557214 TTTTTGTTGTTGTTTTTTGTTGG + Intergenic
1158275424 18:55761672-55761694 TTTTTGTTGTTGTTGTTTGCTGG + Intergenic
1158275425 18:55761675-55761697 TTGTTGTTGTTGTTTGCTGGTGG + Intergenic
1158476244 18:57782239-57782261 TCTGTGTAGTTATTTGCTGCTGG - Intronic
1158745053 18:60190290-60190312 TTTGTTTTGTTTTTTGCAGCTGG + Intergenic
1159182230 18:64923426-64923448 TTTTTGTTGTTGTTAGCAGAAGG - Intergenic
1159316789 18:66785443-66785465 TTTCTCTTGTTCTTTGGTGAAGG + Intergenic
1159364702 18:67450854-67450876 GGTCTGTTGGAGTTTGCTGCAGG + Intergenic
1160706662 19:533023-533045 TTTTTGTTGTTGTTGGGAGCGGG + Intronic
1161132930 19:2602330-2602352 TTTCTGTTGTTGTTTTGAGACGG - Intronic
1161373872 19:3928937-3928959 TTTCTGTTTTTTTTTGGTGGGGG - Intergenic
1162671405 19:12260597-12260619 TTTTTGTTTTTGTTTTTTGCGGG - Intronic
1162679151 19:12325957-12325979 TTGCTGTTCTTGTTTGATGAAGG - Intronic
1163768505 19:19176869-19176891 TTTCTGCTGCTGTTTGCAGAAGG - Intronic
1163952906 19:20607241-20607263 TTTTTGTTGTTTCTTGCTTCTGG - Intronic
1164838518 19:31374752-31374774 CTGCTGTTGTTGTTTGTTGGGGG - Intergenic
1165287919 19:34858235-34858257 GGTCTGTTGGAGTTTGCTGCAGG - Intergenic
1165999378 19:39869253-39869275 TTCCAGTTGCTGGTTGCTGCAGG - Intronic
1167196997 19:48036344-48036366 TTTGTGTTGTTGTGTGGGGCAGG + Intronic
1168170459 19:54585043-54585065 GGTCTGTTGGTGTTTGCTGGAGG + Intronic
1168450799 19:56465149-56465171 TTTCTGCTGTTGTTGGCAGCAGG - Intronic
925049968 2:805715-805737 TTTGTTTTGTTGTTTTCTCCTGG - Intergenic
925258552 2:2510112-2510134 TTTCTTTTTTTTTTTGCTGTTGG - Intergenic
925636487 2:5946293-5946315 TTTTTGTTGTTGCTTGGTTCTGG - Intergenic
925734720 2:6952995-6953017 TTTTTGTTTTTGTTTGTTACAGG + Intronic
925791887 2:7497597-7497619 TTTCTGTTTTTTTTTGTTGTTGG + Intergenic
925989375 2:9241634-9241656 TTTTTGTTGTTGTTTGAGCCTGG - Intronic
926366509 2:12138726-12138748 TGTCTGTTGGAGTTTGCTGGAGG + Intergenic
927667132 2:25040872-25040894 TTTCTTTTGTTTTTTTCTACTGG - Intergenic
928521892 2:32097259-32097281 TTTTTGTTGTTATTTGATGTGGG + Intronic
928989142 2:37213062-37213084 TTTTTGTTGTTGTTTTTTGGGGG - Intronic
929222729 2:39481777-39481799 TTTCTGTTGTTACTTCCTGTTGG + Intergenic
929634228 2:43500716-43500738 TTTTTATTGTACTTTGCTGCTGG - Intronic
929819848 2:45264290-45264312 TGTCTGATGTTATTTGTTGCAGG + Intergenic
930266932 2:49210751-49210773 GTTCTGTTGGAGTTTGCTGGAGG - Intergenic
930312532 2:49759523-49759545 TTTCTGTTTTTCTTTACTTCCGG - Intergenic
930419012 2:51126102-51126124 TTTTTGTGGTTGGTTGCTACAGG + Intergenic
931826435 2:66005245-66005267 TTGCTGGTTTTGTTTCCTGCTGG + Intergenic
931837146 2:66111107-66111129 TTTTTGTTGCTGTTTTCTGCAGG - Intergenic
931993232 2:67811900-67811922 ATTCTCTGCTTGTTTGCTGCTGG - Intergenic
932051477 2:68402995-68403017 GGTCTGTTGGTGTTTGCTGGAGG + Intergenic
932121708 2:69106778-69106800 TTTAGGGGGTTGTTTGCTGCAGG - Intronic
932234925 2:70113198-70113220 TTTCTTTTATTTTTTGCTACAGG - Intergenic
932369231 2:71173812-71173834 TTGCTGTTGTTGTTTGAGACAGG - Intergenic
933100645 2:78252229-78252251 TTTGAGTTGTGGTTTGTTGCCGG + Intergenic
933397118 2:81747201-81747223 TTTCTATGGTTGTTTGATGGAGG + Intergenic
933880510 2:86664555-86664577 GTTCTGTTGGAGTTTGCTGGAGG - Intronic
934911780 2:98264679-98264701 ATTCTGCTGTTGTTTGGTGGAGG + Intronic
936084859 2:109460387-109460409 TCACTGTTGTTCTCTGCTGCTGG + Intronic
936700979 2:115011568-115011590 TTGTTGTTGTTGTTTAATGCTGG + Intronic
937394646 2:121524276-121524298 TTTCTGTTTTTGTTTTCCGTGGG - Intronic
937487419 2:122329740-122329762 TTTGTTTTGTTGTTTTTTGCTGG - Intergenic
937841095 2:126525384-126525406 TTAGTGTTGGTCTTTGCTGCTGG + Intergenic
938161166 2:128985734-128985756 GTTTTGTTGTTGTTTTCTGAAGG + Intergenic
938649438 2:133367121-133367143 TTTCTGCTGTTGTTTTGTTCTGG - Intronic
938657114 2:133445839-133445861 TTGCTGTTGTTGCTTTCTTCAGG - Intronic
938694705 2:133824755-133824777 TTTCTTGTGCTGGTTGCTGCAGG - Intergenic
938792852 2:134692146-134692168 CTTCTGTTCTTGGTGGCTGCTGG - Intronic
939441038 2:142249785-142249807 TTTCTGCTGTTGCTAGCTGCAGG - Intergenic
939725374 2:145713693-145713715 TTTTTGTTGTTGTTTATTTCTGG - Intergenic
940257298 2:151744223-151744245 TGTCTGTTGGAGTTTGCTGAAGG - Intergenic
940644364 2:156375499-156375521 TCTCTGTTGGAGTTTGCTGGAGG + Intergenic
940671237 2:156670861-156670883 TTTTTGTTGTTTTTGGCTGAGGG + Intergenic
941014573 2:160340508-160340530 TTTCTATTGTTGTTTCCTTAGGG - Intronic
941202766 2:162533195-162533217 TTTTTGTTGTTGTTTTATTCTGG - Intronic
941532467 2:166686685-166686707 GTTCTGTTGGAGTTTGCTGGAGG - Intergenic
941803955 2:169691783-169691805 CTGCTGTTGTTGTTTGTTTCAGG + Intronic
942093322 2:172514851-172514873 TTTTTGTTTTTGTTTTCTACTGG - Intergenic
943120627 2:183730473-183730495 TTTTTGTTTTTGTTTGTTGGTGG - Intergenic
943124314 2:183777516-183777538 TTTCTGTTTTAGTTTGCTTATGG + Intergenic
943125372 2:183789512-183789534 GTTCTGTTGGAGTTTGCTGGAGG - Intergenic
943716856 2:191161440-191161462 GGTCTGTTGGAGTTTGCTGCAGG - Intergenic
943778613 2:191795840-191795862 TTTCTGTTGTTGGTAGCAGCTGG + Intergenic
944094034 2:195946530-195946552 TTTCTGTTGGTCTTTGCAACTGG - Intronic
944382349 2:199126100-199126122 TTTCAGGTGTTGTTTGTTTCTGG + Intergenic
944507241 2:200425157-200425179 TTTTTGTTGTTGTTTGTTACAGG - Intronic
944865542 2:203857350-203857372 TTTCAGTTTTTCTTTGCTACAGG + Intergenic
945369952 2:209004306-209004328 CTTCTGTTGTTGTCTGCCTCTGG - Intergenic
945682882 2:212935084-212935106 TTTTTGTTTTTGTTTGGTGAGGG - Intergenic
946513597 2:220387466-220387488 TGTCTGTTGGAGTTTGCTGGAGG + Intergenic
946560906 2:220912331-220912353 TTTCTATTGTTTTTAGTTGCAGG + Intergenic
1170494538 20:16912669-16912691 AGTCTGTTGTAGTTTGCTGGAGG + Intergenic
1171726563 20:28627042-28627064 TTTCTGTTTTTGTTTTATCCTGG - Intergenic
1172217902 20:33249448-33249470 TTTCAGTTGTCGATTGTTGCTGG + Intergenic
1172376292 20:34443680-34443702 TTTACGTTGTTAGTTGCTGCCGG + Intronic
1173063839 20:39690232-39690254 TTTCTGTTGTTGAAGTCTGCTGG - Intergenic
1173096444 20:40034058-40034080 TTTTTGTTGTTGTTTTTTGGTGG + Intergenic
1173160805 20:40651171-40651193 TTTATTATTTTGTTTGCTGCTGG - Intergenic
1173381890 20:42552325-42552347 TTTATGTTTGTGTTTGCTTCTGG - Intronic
1173763938 20:45588920-45588942 TTGTTGTTGTTGTTGGCTTCTGG + Intergenic
1174756507 20:53163851-53163873 TGTTTGTTGTTGTTAGTTGCTGG + Intronic
1175385493 20:58592381-58592403 TTTCTGCTGCTGTTAGCTGCTGG - Intergenic
1175690438 20:61061828-61061850 TTTTTGTTGTTGTTTTCTAGGGG + Intergenic
1176451084 21:6861697-6861719 TGTCTGTTGGAGTTTGCTGGAGG - Intergenic
1176829253 21:13726748-13726770 TGTCTGTTGGAGTTTGCTGGAGG - Intergenic
1177253180 21:18623501-18623523 TTTATTTTGTTGATTGTTGCTGG - Intergenic
1178042282 21:28652473-28652495 TTTCTGTCTTTCTTTCCTGCTGG + Intergenic
1178178331 21:30130204-30130226 TTTGTTTTGTTTTTTTCTGCAGG - Intergenic
1178528926 21:33358162-33358184 TTGTTGTTGTTTTCTGCTGCTGG - Exonic
1181078183 22:20395178-20395200 TTTCTGTTGGTGCTAGCTACTGG + Intronic
1183128575 22:35810004-35810026 TTTCTCTTGTTGTTTGTTTTAGG - Exonic
1183199881 22:36378717-36378739 TTTTTGTTGTTTTTTGTTGGGGG - Intronic
1184086255 22:42267261-42267283 TTTCTGTTGTTGTTTTGAGATGG - Intronic
1184311254 22:43644659-43644681 TTTCTTTTCTTCTTTGCTGCTGG + Intronic
1185265172 22:49898170-49898192 TTTTTGTTGTTGTTTTTTGTAGG + Intergenic
1185382488 22:50516428-50516450 TTTGTGTTGTTTCTTGCAGCTGG + Exonic
949246482 3:1930454-1930476 TTCCTGTTGGAGTTTGCTGGAGG - Intergenic
949512645 3:4780248-4780270 TTTCTTTCCTCGTTTGCTGCTGG + Intronic
950310129 3:11949894-11949916 TGTTTGTTGTTGTTTGCTTAGGG - Intergenic
951051676 3:18100825-18100847 TTTCTGTTGTTGTTACTTGAGGG + Intronic
951067863 3:18288662-18288684 TTTTTGTTGTTGTTTGCTTTAGG + Intronic
951279388 3:20729507-20729529 TTGTTGTTGTTGTTTGATGTAGG + Intergenic
951312705 3:21148417-21148439 TTTCTGGTGCTACTTGCTGCAGG + Intergenic
952517614 3:34121839-34121861 TGTCTGTTGCAGTTTGCTGGAGG + Intergenic
952882324 3:37992554-37992576 TTTGTCTTGTTGTTTACTGTGGG - Intronic
953395223 3:42563795-42563817 GTCCTGTAGCTGTTTGCTGCAGG + Intronic
953653035 3:44823276-44823298 GCTCTGTTGGTGTTTGCTGGAGG + Intronic
953757709 3:45661753-45661775 TTTTTGTTGTTGTTTGTTTTTGG + Intronic
953816302 3:46160754-46160776 ATTCTGTTGTTTTTTGGTGGAGG + Intergenic
955292519 3:57705771-57705793 TTTGTGTTGTTGTTTGAGACAGG - Intergenic
955446517 3:59016831-59016853 TTTCTGTTGTTGTTTTATTAAGG - Intronic
955481682 3:59396039-59396061 GTTCTGTTGGAGTTTGCTGGAGG - Intergenic
956002111 3:64740527-64740549 GTTCTGATGCTGTTTGCTGTAGG + Intergenic
956096098 3:65717926-65717948 TTTCTTATGTTGTTTGCTCTTGG - Intronic
956268870 3:67428345-67428367 GGTCTGTTGTAGTTTGCTGGAGG - Intronic
956318669 3:67969576-67969598 TTGTTGTTGTTGTTTGATGGAGG - Intergenic
956687163 3:71840719-71840741 TTGTTGTTGTTGTTTGCTTTTGG + Intergenic
956856147 3:73276732-73276754 TTTATGTTGTTGTTGGGAGCTGG - Intergenic
956982590 3:74656231-74656253 TTATTGTTGTTGTCTCCTGCTGG + Intergenic
957308402 3:78487931-78487953 GGTCTGTTGTAGTTTGCTGGAGG - Intergenic
957352869 3:79048769-79048791 GGTCTGTTGTAGTTTGCTGGAGG - Intronic
957565493 3:81879014-81879036 TATCTGTTGGAGTTTGCTGGAGG - Intergenic
957695814 3:83636587-83636609 TTTCTGGTGGAGTTTGCTGGGGG - Intergenic
957731417 3:84142711-84142733 TTTCTTTTGTTGTTTACTTGGGG - Intergenic
957933263 3:86910589-86910611 TTATTTTTGTTGTGTGCTGCTGG + Intergenic
958101924 3:89022645-89022667 TTTCTATTGTTCTTTGTTTCAGG + Intergenic
958412352 3:93833158-93833180 TGTCTGTTGGAGTTTGCTGGAGG - Intergenic
958432235 3:94055857-94055879 TTTCTTTAGTTGTATTCTGCAGG - Intronic
959516050 3:107268429-107268451 TTGTTGTTGTTGTTTTCTCCTGG + Intergenic
959955046 3:112227265-112227287 TTTGTTGTGTTGTTTGCTGTTGG - Intronic
960106525 3:113803714-113803736 TTTCTGTTGTGTTTTGGTGAAGG + Intronic
961158270 3:124699786-124699808 TTCCTGTCTTTGTTTGCTGAAGG + Intronic
962836680 3:139195885-139195907 TGTCTGTTGGAGTTTGCTGGAGG + Intronic
963251225 3:143105178-143105200 CTTCTGTTGTTGTCTGCCTCTGG - Intergenic
963444027 3:145379084-145379106 TTTCTGTTGTCGATTACTCCAGG - Intergenic
963984359 3:151574987-151575009 GGTCTGTTGGTGTTTGCTGGAGG + Intergenic
964148247 3:153492320-153492342 TTTTTGTTGTTGTTACCTGTGGG - Intronic
964694114 3:159487722-159487744 TGTCTATTCTTGTTTGCTACAGG + Intronic
965072435 3:163932603-163932625 TTCCTGTTGTTGTTTCATACTGG - Intergenic
965221482 3:165931969-165931991 GATCTGTTGTAGTTTGCTGGAGG - Intergenic
965503312 3:169481937-169481959 TTTTTGTTATTGTTTGGTGGTGG + Intronic
965651444 3:170938171-170938193 TGTCTGTTGGAGTTTGCTGGAGG + Intergenic
965847895 3:172986245-172986267 TTACTGTTGTTGTTTGTTGTTGG + Intronic
966310259 3:178586267-178586289 TCTCTGCTGGTGTTTGCAGCTGG - Intronic
966360410 3:179123078-179123100 TTGCTGTTGTTGTTTGAGACAGG + Intergenic
966493820 3:180557175-180557197 GGTCTGTTGTAGTTTGCTGGAGG - Intergenic
966501157 3:180641592-180641614 TTTCATTTTTGGTTTGCTGCTGG - Intronic
967650481 3:191979466-191979488 TTGTGGTTGCTGTTTGCTGCTGG - Intergenic
968238186 3:197050404-197050426 TATTTGTTGTTGTTTGTTGTTGG - Intronic
968547946 4:1208141-1208163 TCTCTGCTGTTGTTTTTTGCTGG + Intronic
968901003 4:3431773-3431795 CCTCTGCTGTGGTTTGCTGCTGG + Intronic
969198769 4:5584989-5585011 TTTCTGATGTTGCTCCCTGCAGG - Intronic
970269428 4:14328276-14328298 TTGTTGTTGTTGTTTTCTTCAGG - Intergenic
970509959 4:16771973-16771995 TTTCTCTTCTTCTTTGCTGTTGG + Intronic
970744150 4:19275017-19275039 TTACGGTTGTTTTTTACTGCAGG - Intergenic
970868982 4:20792388-20792410 TTGTTGTTGTTGTTTGCTTTGGG - Intronic
972196251 4:36656897-36656919 TGTCTGTTGGGGTTTGCTGGAGG - Intergenic
972706046 4:41544020-41544042 TTTGTCATGTTATTTGCTGCAGG - Intronic
972769473 4:42183871-42183893 TTTTTGTTGTTGTTTGGAGGAGG - Intergenic
972965251 4:44501657-44501679 GGTCTGTTGGTGTTTGCTGGAGG + Intergenic
972984664 4:44749230-44749252 GGTCTGTTGGAGTTTGCTGCAGG + Intergenic
973189877 4:47374638-47374660 GTTCAGATGATGTTTGCTGCAGG - Intronic
973682598 4:53336254-53336276 TTTCTGTTTTTGTTTTCTGTGGG - Intronic
973706275 4:53583924-53583946 TTGTTGTTGTTGTTTGCAGGGGG - Intronic
974102731 4:57435870-57435892 TTTCTGTTGTTTTTGCCTGAGGG + Intergenic
974444027 4:61955799-61955821 TTTCTGTATTAGTTTGCTGAGGG + Intronic
974486522 4:62512810-62512832 TTTATGTTGTTGTTTGTTTTGGG - Intergenic
974566980 4:63590476-63590498 TGTCTGTTGGAGTTTGCTGGAGG - Intergenic
974654406 4:64800348-64800370 GGTCTGTTGGTGTTTGCTGGAGG - Intergenic
975375737 4:73642941-73642963 TTTTTCTTGTTTTTTGCTGTAGG + Intergenic
975463819 4:74686921-74686943 TTTTTGTTGTTGTTTTCTTTTGG + Intergenic
975528824 4:75379118-75379140 GGTCTGTTGGTGTTTGCTGGAGG - Intergenic
975606609 4:76161430-76161452 ATTTTGTTGTTGTTGGGTGCTGG - Exonic
975727094 4:77302837-77302859 TGTCTGTTGGAGTTTGCTGGAGG + Intronic
975889032 4:79002356-79002378 TTTCTTTTATTGTATCCTGCAGG + Intergenic
976191686 4:82493191-82493213 TTTCTATTGTTTTTGGCTGTAGG + Intronic
976611292 4:87033279-87033301 TTCCTGTTGCTTTTTGCTGCTGG + Intronic
976686626 4:87821432-87821454 TTTCTGGTGTGGATAGCTGCCGG - Exonic
976760154 4:88539809-88539831 GTTCTGTTGGAGTTTGCTGGAGG - Intronic
977093413 4:92708381-92708403 TTTCTGTCGTTATTTCCTGGGGG + Intronic
977303010 4:95289391-95289413 TTCATGTTGTTATCTGCTGCTGG + Intronic
977764371 4:100779077-100779099 TTTCTTTTTTTGTTTTCTCCAGG - Intronic
978012829 4:103708409-103708431 GGTCTGTTGGTGTTTGCTGGAGG - Intronic
978191669 4:105920917-105920939 TTTTTGTTGTTGTTTGCTTTGGG - Intronic
978363662 4:107957559-107957581 TGTCTGTTGGAGTTTGCTGAGGG - Intergenic
978535524 4:109757783-109757805 TTTTTGTTTTTGTTTTCTTCAGG - Exonic
978658897 4:111099878-111099900 GGTCTGTTGTTGTTTGCTGAAGG + Intergenic
978771413 4:112460127-112460149 TTTTTGTTTTAGTTTGCTGAGGG - Intergenic
978826865 4:113035172-113035194 TTTTTTTTGGTGTGTGCTGCAGG + Intronic
979898156 4:126187154-126187176 TTGTTGTTGTTGTTTCCTGGTGG + Intergenic
979934142 4:126670610-126670632 GGTCTGTTGGTGTTTGCTGGAGG - Intergenic
980126113 4:128775872-128775894 TTGCTGTTGTTGTTAACTTCTGG + Intergenic
980410781 4:132415094-132415116 TTATTGTTGTTGTTTTCTGGTGG - Intergenic
981149779 4:141367947-141367969 GGTCTGTTGGAGTTTGCTGCAGG + Intergenic
981451454 4:144902659-144902681 TTTTTTTTTTTTTTTGCTGCTGG - Intergenic
982191370 4:152859066-152859088 TTTTTGTTTTTGTTTGAGGCAGG + Intronic
982340236 4:154290143-154290165 TTTTTCATATTGTTTGCTGCTGG - Intronic
982932918 4:161430733-161430755 TTTTTGTTTTTGTTTTCTGACGG - Intronic
983109378 4:163729204-163729226 TTTCTTTTTTTGTTTCCTCCAGG - Intronic
983307659 4:166013543-166013565 TTTTTGTTGTTGTTTGTTTTTGG + Intronic
983425874 4:167582630-167582652 TTTCTGGTGTTTTTTCCTTCTGG - Intergenic
983825891 4:172259635-172259657 TTGTTTTTGTTGTTTGCTGTTGG + Intronic
984351385 4:178599562-178599584 TTTCTTTTGTTGTTTACTGTGGG + Intergenic
985208053 4:187561819-187561841 CTTCTCTTGCTGTTTCCTGCTGG + Intergenic
985442595 4:189994223-189994245 TTCCTGCTCTTGTTTGCTGAGGG - Intergenic
985501067 5:246005-246027 TTTCTTTTGTTAATTGCTGAGGG - Intronic
986141975 5:5039599-5039621 TTTTTGTTGTTGTTCACTGATGG - Intergenic
986185518 5:5432842-5432864 TTTCAGTTTTTGTTTACTTCAGG + Intronic
986386942 5:7243912-7243934 TCCTTATTGTTGTTTGCTGCAGG - Intergenic
986501744 5:8408167-8408189 TCTCCGTGGTTGTTTCCTGCAGG + Intergenic
987899363 5:23991280-23991302 TTGCTGTTGTTGTTTTCTTCTGG + Intronic
988023592 5:25655092-25655114 GGTCTGTTGTAGTTTGCTGGAGG + Intergenic
988125181 5:27023551-27023573 TTTATTTGTTTGTTTGCTGCAGG + Intronic
989779837 5:45250494-45250516 TTTTTGTTTTTGTTTTCAGCCGG - Intergenic
989784709 5:45313269-45313291 TGTCTGTTGGAGTTTGCTGGAGG - Intronic
990239268 5:53800226-53800248 GTTCTGTTGGAGTTTGCTGGAGG - Intergenic
990482243 5:56222248-56222270 GGTCTGTTGGTGTTTGCTGGAGG - Intronic
990795129 5:59531438-59531460 TTTCTGTAGTTTTCTGCTGCTGG + Intronic
990810962 5:59722902-59722924 TTTCTGTTGTTGAATGCTTTTGG + Intronic
990887970 5:60616045-60616067 GGTCTGTTGGTGTTTGCTGGAGG - Intronic
990942655 5:61218830-61218852 TTTGTGTTGTTTGTTTCTGCTGG + Intergenic
992336400 5:75774788-75774810 TGTCTGTTGGAGTTTGCTGGAGG + Intergenic
992756557 5:79911846-79911868 TGTCTGTTGGAGTTTGCTGGAGG - Intergenic
993289403 5:86045598-86045620 CTTTTGTTGTTGTTTTCTGATGG - Intergenic
993314013 5:86376106-86376128 TCTCTGTTGTTGTTTGGGCCAGG - Intergenic
993505592 5:88705146-88705168 TTTTTGTTGTTGTTTGTTTTTGG - Intergenic
993585343 5:89719903-89719925 CTACTGTTATTGTTTGTTGCTGG + Intergenic
993720574 5:91317795-91317817 TTGTTGTTGTTGTTTGAAGCAGG + Intergenic
993891448 5:93479518-93479540 TTGTTGTTGTTGTTTGATGAAGG - Intergenic
994636648 5:102352169-102352191 TGTCTGTTGGAGTTTGCTGGAGG - Intergenic
994657609 5:102612978-102613000 GTGCTGTGGTGGTTTGCTGCAGG + Intergenic
995564154 5:113416038-113416060 GGTCTGTTGGTGTTTGCTGGAGG + Intronic
995642895 5:114278113-114278135 TGTCTGTTGGAGTTTGCTGCAGG + Intergenic
995757460 5:115524026-115524048 ATTCTGGTTTTGTTTGCTGTTGG - Exonic
996335984 5:122384658-122384680 TTTCTGTGGGTGTTTCCTTCAGG + Intronic
996420615 5:123258401-123258423 GTTCTGTTGGAGTTTGCTGGAGG + Intergenic
996581347 5:125035355-125035377 TTTCTTTTCTTGATTGCTTCAGG - Intergenic
996815794 5:127571193-127571215 TTTCTGATGTGGTTTTCTGTTGG + Intergenic
996938265 5:128973035-128973057 GGTCTGTTGTAGTTTGCTGGAGG + Intronic
998031791 5:138876753-138876775 TTTCTGTTGTAGTGTTGTGCTGG + Intronic
999890625 5:155975039-155975061 CTTCTGCTGTTGTTTTCTCCAGG - Intronic
999963581 5:156783686-156783708 ATTCTGTTGGAGTTTGCTGGAGG - Intergenic
999999560 5:157124752-157124774 TTTTTGTTGTTGTTTTTTGGGGG + Intronic
1000000090 5:157129687-157129709 TTTAAGTTATTGTTTGTTGCTGG + Intronic
1000649473 5:163798551-163798573 TTTTTGTTGTTTTTTGCTTTTGG + Intergenic
1000959864 5:167587078-167587100 ATTCTGTTGTTGTTTCCAGTGGG + Intronic
1000968806 5:167691594-167691616 TTTCTGGTGGTGATTGCTGAGGG - Intronic
1002216504 5:177638779-177638801 GTTCTGTTGGAGTTTGCTGGAGG + Intergenic
1004076018 6:12344864-12344886 TTTTTGTTGTTGTTTGAGACAGG + Intergenic
1004703768 6:18103857-18103879 TTTCTGTAGTTGTTTTCTGTAGG - Intergenic
1004831621 6:19482627-19482649 TGTCTGTTGGAGTTTGCTGGAGG - Intergenic
1005252673 6:23965321-23965343 TTTTTGTTGTTGTTTGTTTTTGG + Intergenic
1006551951 6:34831644-34831666 TTGTTGTTGTTGTTTGATGAAGG + Intronic
1006736987 6:36280793-36280815 TTGTTGTTGTTGTTTGAGGCAGG + Intronic
1007567842 6:42866399-42866421 TGTATGTTTTTGTTTGTTGCTGG + Exonic
1008219653 6:48840153-48840175 TTTCAGTTCTTGTCTTCTGCTGG + Intergenic
1008221050 6:48853780-48853802 TTGTTGTTGTTGTTTGCTTTTGG - Intergenic
1008464032 6:51810360-51810382 TTTTTGTTGTTGTTTTCTTTTGG - Intronic
1008807797 6:55453159-55453181 TTGTTGTTGTTGTTTGTTGTTGG + Intronic
1009669309 6:66726330-66726352 TTTGTTTTGTTGTTTGGTGGGGG - Intergenic
1009692347 6:67052081-67052103 TTTTGTTTGTTGTTTGCTGTTGG + Intergenic
1010154285 6:72774659-72774681 TTCCTATTGTTTTTTGCTGTTGG - Intronic
1010683011 6:78818409-78818431 TGTCTGTTGGAGTTTGCTGGAGG - Intergenic
1010993052 6:82501675-82501697 GATCTGTTGTAGTTTGCTGGAGG + Intergenic
1011375119 6:86679262-86679284 TTTCTTTTCTTGTTTCCTTCTGG + Intergenic
1011713593 6:90080634-90080656 TTGCTGTTGTGGTTTGCAGAGGG - Intronic
1011949943 6:92952760-92952782 GTTCTGTTGGAGTTTGCTGGAGG - Intergenic
1011956750 6:93032907-93032929 GTTCTGTTGGAGTTTGCTGGAGG - Intergenic
1012548122 6:100443006-100443028 TTTTTGTTGTTGTTTGCATATGG - Intronic
1012617686 6:101297252-101297274 ATTCTGCTGTTTTCTGCTGCTGG + Intergenic
1012805854 6:103891747-103891769 GTTTTGTTTTTGTTTGCTGGTGG + Intergenic
1012884692 6:104832397-104832419 TTGTTGTTGTTGTTTGATACAGG + Intronic
1013073695 6:106751995-106752017 TTTCAGCTACTGTTTGCTGCTGG + Intergenic
1013659119 6:112276550-112276572 TTTCTGTTCTTGTTAGCTAAGGG + Intergenic
1013810062 6:114034750-114034772 TTTCCCTTTTTGTTTGCTTCAGG + Intergenic
1014424349 6:121285891-121285913 GGTCTGTTGTAGTTTGCTGGAGG - Intronic
1014566881 6:122960125-122960147 GAACTGTTGTTGTTTGCTGATGG + Intergenic
1014605095 6:123463581-123463603 ATTCTGTTGTTGTTTCCAGATGG - Intronic
1015430251 6:133122896-133122918 GGTCTGTTGCAGTTTGCTGCAGG + Intergenic
1015464557 6:133534285-133534307 TTTTTGTTGTTGTTTGTTTCAGG - Intergenic
1015813587 6:137185544-137185566 TTTTTGTTGTTGTCTGCCTCTGG + Intergenic
1015941076 6:138452833-138452855 TTTCTGTTGTTGTTGGCGCCAGG - Intronic
1016202949 6:141434912-141434934 TTCCTGTGTTTGTTTGCTGAGGG - Intergenic
1016572196 6:145526892-145526914 TTTCTATTGCTTTTTGATGCAGG + Intronic
1016875780 6:148863743-148863765 GGTCTGTTGGAGTTTGCTGCAGG + Intronic
1017411592 6:154173040-154173062 CGTCTGTTGGAGTTTGCTGCAGG - Intronic
1017546109 6:155451931-155451953 TTTCTGATGTCTTTTGATGCTGG + Intronic
1017623504 6:156324749-156324771 TTACTGTTGCTTTTTGTTGCTGG + Intergenic
1018092791 6:160359698-160359720 TTTCTGTTGTTTTTATCTCCTGG - Intronic
1018146510 6:160895547-160895569 TTCTTATTGTTGTATGCTGCTGG - Intergenic
1018275060 6:162121647-162121669 GTTCTGTTGTGGTTAGCTGCTGG + Intronic
1018565884 6:165152863-165152885 ATTTTGTTATTGTTTGTTGCTGG - Intergenic
1018600017 6:165528436-165528458 TTAGTGTTGGTGTCTGCTGCTGG - Intronic
1018796139 6:167186965-167186987 TTTCTGTTGTTTGGAGCTGCTGG + Intronic
1018820182 6:167368092-167368114 TTTCTGTTGTTTGGAGCTGCTGG - Intronic
1021392874 7:20116125-20116147 TTTCTGTTTTTGTTTTCTAAAGG - Intergenic
1021562072 7:21978483-21978505 TTTCTATTTTTGTTTTGTGCAGG - Intergenic
1021856087 7:24857795-24857817 TTTGTGTTGTTTTTTGCTGCAGG + Intronic
1022165414 7:27755192-27755214 TGTCTGTTGTTGTATGTTTCTGG + Intronic
1022220664 7:28310369-28310391 TGTCTGTTGGTGTTTGGTGTAGG + Intronic
1022867072 7:34432182-34432204 GGTCTGTTGGAGTTTGCTGCAGG - Intergenic
1023110264 7:36803102-36803124 TTTCTGTTTTTGTTTATTTCTGG + Intergenic
1023371098 7:39512878-39512900 TTTTTGTTTTTGTTTGAGGCAGG + Intergenic
1023602731 7:41896071-41896093 TTTCTGTTTCTGTCTCCTGCTGG + Intergenic
1023718963 7:43073302-43073324 TTTCTGTTATTGTCTGCCTCTGG + Intergenic
1024031774 7:45467733-45467755 TGTCTGTTGGAGTTTGCTGGAGG + Intergenic
1024437948 7:49381301-49381323 CTTCTGTTGTTGTCTGCCTCTGG - Intergenic
1025027646 7:55530935-55530957 TTTCTCTTGTGGTTTGTTCCTGG - Intronic
1025593929 7:62900747-62900769 TGTCTGTTGGAGTTTGCTGGAGG - Intergenic
1025634305 7:63308045-63308067 TTGTTGTTGTTGTTTGTTTCAGG - Intergenic
1025648393 7:63440121-63440143 TTGTTGTTGTTGTTTGTTTCAGG + Intergenic
1025741705 7:64203061-64203083 ATTTTGTTGTTGTTTGTTTCAGG + Intronic
1025746166 7:64244990-64245012 ATTTTGTTGTTGTTTGTTTCAGG + Intronic
1026748916 7:73034416-73034438 TTTTTGTTGTTGTTTGAGACAGG - Intergenic
1026752564 7:73062561-73062583 TTTTTGTTGTTGTTTGAGACAGG - Intergenic
1026756215 7:73090692-73090714 TTTTTGTTGTTGTTTGAGACAGG - Intergenic
1027035113 7:74919711-74919733 TTTTTGTTGTTGTTTGAGACAGG - Intergenic
1027091190 7:75302732-75302754 TTTTTGTTGTTGTTTGAGACAGG + Intergenic
1027094835 7:75330705-75330727 TTTTTGTTGTTGTTTGAGACAGG + Intergenic
1027181526 7:75943719-75943741 TTTCAGTTGTTGTTTACTTGGGG - Intronic
1027324505 7:77036980-77037002 TTTTTGTTGTTGTTTGAGACAGG - Intergenic
1027370464 7:77504485-77504507 TTTGTGTTTTTATTTGCTACAGG - Intergenic
1027527032 7:79282452-79282474 TTTTTGTTGTTGTTTTCTGCAGG + Intronic
1027822701 7:83067967-83067989 TTGCTGTTGTTGTTTTAAGCGGG + Intronic
1028098144 7:86787402-86787424 TCTTTGTTGATGTTGGCTGCAGG + Intronic
1028111259 7:86945137-86945159 TTTCTGCTGTACTTTGCTGATGG - Intronic
1028141864 7:87282924-87282946 TCACTGTTGGTCTTTGCTGCTGG - Intergenic
1028417382 7:90595609-90595631 TTTTTGTTGTTGTTTGCGGTGGG - Intronic
1028454999 7:91028785-91028807 TTTTTGTTTTTGTTTTTTGCTGG + Intronic
1029294839 7:99532002-99532024 TTTTTGATGTTGTTTGGTGTGGG - Exonic
1029394943 7:100301428-100301450 TTTTTGTTGTTGTTTGAGACAGG + Intergenic
1029994505 7:104993877-104993899 ATTAAGTTGATGTTTGCTGCAGG - Intergenic
1030142691 7:106321023-106321045 GGTCTGTTGTAGTTTGCTGGAGG - Intergenic
1030220948 7:107098755-107098777 GGTCTGTTGTAGTTTGCTGGAGG + Intronic
1030828578 7:114191809-114191831 TTTGTGTTGTTTTTTTCCGCGGG + Intronic
1031044557 7:116873299-116873321 TTTTTGTTGTTGTTTTTTGGTGG + Intronic
1031145390 7:117992043-117992065 TTTTTGTTGTCTTTTGCTTCAGG + Intergenic
1031184108 7:118454317-118454339 TTTCTGTTGTTATTTTCCCCTGG + Intergenic
1031205034 7:118745491-118745513 TTTCTGGTGAGATTTGCTGCTGG - Intergenic
1031338201 7:120564374-120564396 TTACTATTGTAGTTTTCTGCAGG - Intronic
1031359709 7:120834436-120834458 TTTCTGTTGCTTTTTGATGAGGG + Intronic
1031817563 7:126456919-126456941 TTTTTGTTGTTGTTTGCCCACGG - Intronic
1031947572 7:127857913-127857935 TTCCTGATGGTGTTTACTGCCGG - Intronic
1032262883 7:130350909-130350931 TTTCTGCAGCTGCTTGCTGCTGG + Intronic
1032631724 7:133660378-133660400 TGTCTGCTTGTGTTTGCTGCAGG + Intronic
1032757479 7:134904795-134904817 TTTCTGTTCTTCTTTGGGGCTGG - Intronic
1032845768 7:135750199-135750221 TTTCTGTTGGAGAGTGCTGCTGG - Intergenic
1034040028 7:147868217-147868239 GTTCTGTTGGAGTTTGCTGGTGG + Intronic
1034057041 7:148046084-148046106 TTTTTGTTTTTGTTTGAGGCAGG + Intronic
1034377098 7:150655716-150655738 TTTCTGTAGCTGCTTCCTGCTGG + Intergenic
1034596662 7:152201593-152201615 TCTTTGTTGTTGTTTTCTCCTGG - Intronic
1036565934 8:9938097-9938119 TTTCTGTTGTCTCTGGCTGCCGG - Intergenic
1037197203 8:16205025-16205047 GTTCTGTTGGAGTTTGCTGGAGG - Intronic
1037268349 8:17095184-17095206 GTTCTGTTGTTTGTTTCTGCTGG + Intronic
1037663014 8:20943257-20943279 GTTCTATTCTTGATTGCTGCAGG + Intergenic
1037700287 8:21267627-21267649 TGTCTGTTTTTGTTTGTTGCAGG - Intergenic
1038221656 8:25614597-25614619 GGTCTGTTGGTGTTTGCTGGAGG + Intergenic
1038299248 8:26326936-26326958 TTTCTGTTCTTGGTTGCAGTAGG + Intronic
1038342739 8:26701127-26701149 TTTCTCTTGTTGTCTGCTATTGG + Intergenic
1038615639 8:29091421-29091443 TTTCAGTTGCTGTTTGGTGAAGG - Intronic
1038769122 8:30459905-30459927 TGTCTTTTGTTGTTTCCAGCAGG + Intronic
1039051323 8:33497331-33497353 TTTTTTTTTTTTTTTGCTGCAGG - Intronic
1039123939 8:34179552-34179574 ATTCTCTGCTTGTTTGCTGCTGG - Intergenic
1039307969 8:36284393-36284415 TTTTTCATGTTGTTTGCTGCTGG + Intergenic
1039719105 8:40143435-40143457 TGTCTGTTGGAGTTTGCTGGAGG + Intergenic
1040463076 8:47668806-47668828 TGTTTGTTGTTGTGTGTTGCTGG - Intronic
1040547217 8:48408013-48408035 TTTATGTTGGTGTGTGCAGCTGG + Intergenic
1041822116 8:62048370-62048392 TTTTTGTTGTTGTTTTTTGATGG + Intergenic
1041905078 8:63023581-63023603 TTTATTTTGTTGTTGGCTGGAGG + Intronic
1041963563 8:63648351-63648373 TTTGTTGTGTTGTTTCCTGCAGG + Intergenic
1042569927 8:70152672-70152694 TTTCTGTTACTGTTTCCTGCTGG + Intronic
1042631085 8:70816999-70817021 TTTCTCTTGATGTTGGCTGTGGG - Intergenic
1043030217 8:75124933-75124955 TTTTTGTTGTTGTTTTCTGGGGG - Intergenic
1043182797 8:77106386-77106408 GGTCTGTTGGAGTTTGCTGCAGG - Intergenic
1043267539 8:78285602-78285624 TTTTTGTTGTTGTTGCTTGCGGG + Intergenic
1043336807 8:79186150-79186172 TTTTTGTTGGTTTCTGCTGCTGG + Intergenic
1043739438 8:83791795-83791817 TTTTTGTTGTTGCTTTCTGTTGG + Intergenic
1043828284 8:84955861-84955883 TTGTTGTTGTTGTTTGGTGTGGG + Intergenic
1044163011 8:88944420-88944442 ATTTTGGTGTTGTTTGCTGTGGG + Intergenic
1044364939 8:91333890-91333912 TCTGTGTTCTTGTTTGCTTCTGG + Intronic
1044415086 8:91929452-91929474 TTTTTGTTTTTGTTTGAGGCAGG + Intergenic
1044473880 8:92604130-92604152 TCTCTGAAGTTGTTTGCTGCAGG + Intergenic
1045080795 8:98623776-98623798 TTTTTGTTTTTGTTTGAGGCAGG - Intronic
1045400089 8:101806195-101806217 TTTCTGTTGCTGTTTGCTTGGGG - Intronic
1045458081 8:102401730-102401752 TTTCTGTAGTTGTTTTTTGGGGG - Intronic
1045718144 8:105073149-105073171 TTTTTTTTTTTTTTTGCTGCAGG - Intronic
1046292161 8:112177300-112177322 TTTGTGTTGTTGTTTTTTCCTGG + Intergenic
1046424435 8:114028086-114028108 TTTTTGTTGTCGTTTGCTTTTGG + Intergenic
1046851635 8:118980876-118980898 TTTTTGTTTTTGTTTGCAGGGGG + Intergenic
1046928390 8:119817873-119817895 TTTTTGTTTTTGTTTTCTGGGGG + Intronic
1047129434 8:122002120-122002142 GGTCTGTTGGTGTTTGCTGGAGG - Intergenic
1048095060 8:131283332-131283354 TTTTTGTTGTTGTTAGTTCCTGG + Intergenic
1049491028 8:142902383-142902405 TATCTGTTGGTGTATGCTGCTGG - Intronic
1049629676 8:143646668-143646690 TTTTTGTTGTTGTTTGAGACAGG + Intronic
1050504246 9:6330739-6330761 TTTCATTTCTTGTATGCTGCAGG - Intronic
1051151003 9:14079069-14079091 TTGTTGTTTTTGTTTGCTGTAGG - Intergenic
1052739248 9:32377555-32377577 TTTTTGTTGTTGTTTTTTTCAGG + Intergenic
1052992841 9:34531781-34531803 TGTCTGTTGGAGTTTGCTGGAGG + Intergenic
1053478452 9:38398777-38398799 TTTCTGTTTTTGTTTTCTCTTGG + Intergenic
1053590498 9:39509659-39509681 TTGTTGTTGTTGTTTGTTGAGGG - Intergenic
1053832551 9:42098599-42098621 TATCTGTTTTTTTTTGCTGTTGG - Intronic
1054575805 9:66855630-66855652 TTGTTGTTGTTGTTTGTTGAGGG + Intergenic
1054844408 9:69777799-69777821 TTTATGTTTTTCTTTGCTGTTGG + Intergenic
1055141898 9:72885903-72885925 TTTTTATTGTTGTTTACTTCCGG + Intergenic
1055998024 9:82182912-82182934 TTCATGTTGTTGATTGCTACAGG + Intergenic
1056008513 9:82301286-82301308 TTTTTGTTGTTGTCTGCTACTGG + Intergenic
1056099873 9:83291117-83291139 TTTTTGTTTTTGTTTGTTGGTGG - Intronic
1056680520 9:88713789-88713811 TTTCTGTTTTTGTTTGAGGTTGG - Intergenic
1056853948 9:90108944-90108966 TGTCTCTAGTTGTCTGCTGCTGG + Intergenic
1057122241 9:92586851-92586873 TTGCTGTTGTTGATTGCTGAGGG - Intronic
1057418672 9:94889484-94889506 TTTTTGTTGTTGTTTGTTTTTGG + Intronic
1058192911 9:101940645-101940667 TGTCTGTTGGAGTTTGCTGGAGG + Intergenic
1058268891 9:102943933-102943955 TTTTTGTTGTTGTTTGGTAGGGG + Intergenic
1058273116 9:103001476-103001498 TTTCTCTAGTTGTTGGTTGCAGG + Intronic
1058314654 9:103550130-103550152 ATTATGTTGTTGCTTTCTGCTGG - Intergenic
1058648353 9:107151988-107152010 TTTCTGGAGTTGTCTGCTCCAGG - Intergenic
1058826109 9:108777387-108777409 TTGCTTTTGTTTTTTGCTGGAGG + Intergenic
1059076411 9:111197825-111197847 TTGTTGTTGTTGTTTTCTGTTGG - Intergenic
1059575436 9:115483353-115483375 TTGCTGTTGTTGCTTGGTGAGGG + Intergenic
1059820965 9:117971550-117971572 TTTCATTTGTTGTTTGCTATAGG + Intergenic
1060511540 9:124238208-124238230 TTGCTGTTGTTGTTTGAGACGGG + Intergenic
1061105348 9:128526013-128526035 TTGTTGTTGTTGTTTTTTGCGGG + Intronic
1061358290 9:130123049-130123071 TTTCTGTTGTTTTTTGAGACTGG + Intronic
1062688905 9:137831216-137831238 TTTCTGCTGATGGTTACTGCAGG - Intronic
1203518097 Un_GL000213v1:22820-22842 TGTCTGTTGGAGTTTGCTGGAGG + Intergenic
1186394847 X:9197428-9197450 TGTTTATTGTTGTTGGCTGCTGG - Intergenic
1186829567 X:13377252-13377274 TTTCTATTACTGTTTGATGCTGG + Intergenic
1188081499 X:25847211-25847233 TTTTTGTTTTTGTTTGTTGGGGG + Intergenic
1188590901 X:31833962-31833984 TTTCTGTTTTTGTTTTTTGGGGG - Intronic
1188692797 X:33150901-33150923 TCTCTGTTGTGGTTTGCTTCAGG - Intronic
1189045542 X:37587034-37587056 TGTCTGTTGGAGTTTGCTGGAGG + Intronic
1189111851 X:38299141-38299163 TTTCTGTGGATTTATGCTGCAGG - Exonic
1189392738 X:40590382-40590404 TTTGTTTTGTTTTTTGCTACAGG + Intronic
1189572586 X:42314858-42314880 GTTGTTTTGTTGTTTGCTGTGGG + Intergenic
1189581599 X:42413278-42413300 TTGTTGTTGTTGTTTTCTGTTGG + Intergenic
1190603076 X:52112014-52112036 TGTCTGTTGGTGTTTTCTGGAGG - Intergenic
1191017748 X:55827978-55828000 GTTCTGTTGGAGTTTGCTGGAGG - Intergenic
1191705207 X:64086488-64086510 GGTCTGCTGGTGTTTGCTGCAGG - Intergenic
1191826257 X:65367829-65367851 TTTGTGTTGTTTCTTGGTGCCGG - Intronic
1191946478 X:66539953-66539975 TCAGTGTTGGTGTTTGCTGCAGG - Intergenic
1192045123 X:67664354-67664376 GGTCTGTTGGAGTTTGCTGCAGG + Intronic
1192140304 X:68641587-68641609 TTTCTGTTTTTGCTCTCTGCAGG - Intergenic
1192409250 X:70918430-70918452 TTGTTGTTGTTGTTTGAGGCAGG + Intergenic
1192422475 X:71045771-71045793 TTTTTGTTGTTGTTTGAGACAGG + Intergenic
1193000866 X:76560440-76560462 GGTCTGTTGCTGTTTGCTGGAGG - Intergenic
1193007138 X:76632948-76632970 AAACTGTTGTTGTTTGCTGATGG - Intergenic
1193073918 X:77334827-77334849 TGTCTGTTGGAGTTTGCTGGAGG - Intergenic
1193189214 X:78549555-78549577 TGTCTGTTGGAGTTTGCTGGAGG - Intergenic
1193376489 X:80767429-80767451 GGTCTGTTGGTGTTTGCTGGAGG - Intronic
1193387883 X:80892859-80892881 GTTCTGTTGGAGTTTGCTGGAGG + Intergenic
1193719748 X:84973337-84973359 TTTCTGTTGTTTTTGTCTTCTGG - Intergenic
1193753598 X:85378977-85378999 TGTCTGTGGTTGTTTGTTTCCGG - Intronic
1194016951 X:88634534-88634556 CTTTTTTTGTTGTTTGCTGTTGG - Intergenic
1194203031 X:90978397-90978419 GGTCTGTTGTAGTTTGCTGGAGG + Intergenic
1194225068 X:91246107-91246129 TTTCTGTGGTTCTTTGCAGCTGG + Intergenic
1194465399 X:94228920-94228942 TTGCTGTTGTTGTTTTCTGTTGG - Intergenic
1194523233 X:94943468-94943490 GTGCTGTTGTAGTTTGCTGGGGG - Intergenic
1194677763 X:96814796-96814818 GGTCTGTTGGTGTTTGCTGGAGG + Intronic
1195047982 X:101071388-101071410 TTTTTGTTGTTGTTTTTTGTTGG - Intergenic
1195161692 X:102177942-102177964 TTTTTTTTTTTTTTTGCTGCAGG + Intergenic
1195788088 X:108549278-108549300 ATTCTGTAGTTGTTTGATGTTGG - Intronic
1196488900 X:116245625-116245647 TTTCTTTTATTGTTTCCTTCTGG - Intergenic
1196818394 X:119683518-119683540 TTCCTGTTGTTGTTTGCCTTTGG - Intronic
1196976143 X:121159766-121159788 TTTCTTTTATTATTTGCTACTGG + Intergenic
1197478075 X:126947656-126947678 GGTCTGTTGGTGTTTGCTGGAGG - Intergenic
1197658714 X:129146537-129146559 TCTCTGTTGTTTTTTGGTGAAGG - Intergenic
1198514914 X:137397004-137397026 TTTGTCTTCTTGTTTGCTGTGGG + Intergenic
1199735399 X:150681308-150681330 TTTCTATTGATGTTCGCTGAAGG - Intergenic
1199796797 X:151206323-151206345 TGTCAGTTGTTTTTTGCTGGAGG - Intergenic
1199930964 X:152521117-152521139 TTGCTGTTGCTGCTTGCTACTGG - Intergenic
1200174461 X:154103314-154103336 TTTTTGTTTTTGTTTTCTTCAGG - Intergenic
1200548865 Y:4553823-4553845 TGTCTGTTGTAGTTTGCTGGAGG + Intergenic
1200561532 Y:4709414-4709436 TTTCTGTGGTTCTTTGCAGCTGG + Intergenic
1200758861 Y:7017330-7017352 TTGTTGTTGTTGTTTTCAGCTGG - Intronic
1200966689 Y:9045409-9045431 TTTCTTTTCTTGTTTCCTTCTGG - Intergenic
1201013369 Y:9573034-9573056 GTTCTGTTGGAGTTTGCTGGAGG + Intergenic
1201522167 Y:14887768-14887790 TGTCTGTTGGAGTTTGCTGTAGG + Intergenic
1201541902 Y:15114005-15114027 TTTCTGTTGGAGTTTGCTGGAGG - Intergenic
1201566448 Y:15369570-15369592 GTTCTGTTGGAGTTTGCTGGAGG - Intergenic
1201670549 Y:16515694-16515716 GGTCTGTTGGTGTTTGCTGGAGG + Intergenic
1201758086 Y:17511689-17511711 TGTTTGTTTTAGTTTGCTGCTGG - Intergenic
1201843469 Y:18394301-18394323 TGTTTGTTTTAGTTTGCTGCTGG + Intergenic
1201979260 Y:19890232-19890254 TGTCTGCTGTAGTTTGCTGGAGG + Intergenic
1202066186 Y:20943026-20943048 GTTCTGTTGGAGTTTGCTGGAGG + Intergenic
1202070244 Y:20984903-20984925 GTGCTGTTGTGGTTTGCTGGGGG + Intergenic
1202089943 Y:21178895-21178917 TTTCTTTTCTTGTTTCCTTCTGG + Intergenic