ID: 1150437465

View in Genome Browser
Species Human (GRCh38)
Location 17:65165115-65165137
Sequence CAGAGCAGACAGGAGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1023
Summary {0: 1, 1: 0, 2: 5, 3: 97, 4: 920}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150437465_1150437469 4 Left 1150437465 17:65165115-65165137 CCTTCTTCCTCCTGTCTGCTCTG 0: 1
1: 0
2: 5
3: 97
4: 920
Right 1150437469 17:65165142-65165164 GGACTATCCCAGCAACCCACAGG 0: 1
1: 0
2: 1
3: 3
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150437465 Original CRISPR CAGAGCAGACAGGAGGAAGA AGG (reversed) Intronic
900158920 1:1214218-1214240 CAGAGGAGGCGGGAGGAGGAAGG + Intergenic
900325277 1:2105754-2105776 CAGAGCTGTCAGGAGGAGCAGGG + Intronic
900371462 1:2334039-2334061 CAGAGCAGACAGAAGGCATGGGG + Intronic
900422864 1:2563148-2563170 CGGAAAAGACAGGAGGCAGAAGG + Exonic
900510057 1:3054563-3054585 CAGAGAAGACAGGTCAAAGAGGG + Intergenic
900511114 1:3061653-3061675 GAGGGCAGGCAGGAGGGAGAAGG + Intergenic
900803970 1:4755415-4755437 CAGAGCCAGCAGGAGGGAGACGG - Intronic
901513574 1:9730581-9730603 GAGAGCAGCGAGGAGGAGGAGGG - Exonic
902157200 1:14498310-14498332 CAGAGCAGGCAGGAGAAGGCTGG - Intergenic
903033771 1:20481401-20481423 GGGGGCAGGCAGGAGGAAGAGGG - Intergenic
903049377 1:20589397-20589419 CAGCGGAGACTGGGGGAAGAAGG - Intronic
903214256 1:21834595-21834617 CAGAGCGGGCAGGCAGAAGATGG + Intronic
903222738 1:21878117-21878139 CACAGCTGGGAGGAGGAAGAAGG - Intronic
903395294 1:22997435-22997457 AAGAGAAAATAGGAGGAAGAAGG - Intergenic
903476756 1:23624807-23624829 CGGAGATGACAGCAGGAAGAAGG + Intronic
903857139 1:26344100-26344122 CAGCGCAGGCAGGAGAAAGCTGG - Exonic
903935830 1:26894238-26894260 CAGTTCTGGCAGGAGGAAGAAGG - Exonic
904323386 1:29711136-29711158 GAGGGGAGAAAGGAGGAAGAGGG + Intergenic
904431266 1:30466090-30466112 CAGGGCAGAGGCGAGGAAGATGG - Intergenic
904600135 1:31668470-31668492 CAGAGCAGGCATGAGGACCAGGG + Intronic
904848627 1:33440173-33440195 CACAGCAGACATGAAGAATATGG + Intergenic
904869080 1:33605193-33605215 CAGAGCAGGTAGGTGGAACATGG + Intronic
904931155 1:34088395-34088417 AAGAGCTTACAGGAGGGAGATGG - Intronic
905074884 1:35261699-35261721 AAGAGGAGGAAGGAGGAAGAAGG - Intergenic
905118970 1:35667100-35667122 CAGAGGAGGCAAGAGGAAGAAGG - Intergenic
905120664 1:35679428-35679450 CAGAGAAGCCAGGAGGAGGGAGG - Intergenic
905518637 1:38580543-38580565 CCCAGCAGACAGGAGGAGGATGG - Intergenic
906665592 1:47619543-47619565 CAGAGCAGACAAGATGGACAAGG + Intergenic
906758669 1:48348853-48348875 CAAAGAAGCCAGGAGGATGAAGG - Intronic
907403241 1:54238549-54238571 CAGGGGACACAGGAGGAAGTGGG + Intronic
907767112 1:57423200-57423222 TGGAGCAGAGAGAAGGAAGAGGG + Intronic
908322406 1:62991220-62991242 GAGAGGAGACAGGAGGAGGTGGG + Intergenic
909793275 1:79701558-79701580 CGGAGCAGAGAGCAGGAGGACGG + Intergenic
910049072 1:82955774-82955796 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
910216579 1:84850095-84850117 CAGAGGAGACAGGCGGAAGAAGG + Intronic
910866846 1:91796626-91796648 CAGAGGACACAGGAGGAAATGGG + Intronic
911089776 1:94009320-94009342 CAGGGCAGACTGGAGGAAGTGGG - Intronic
911176848 1:94825842-94825864 CAAAGAAGACAGGAGGAGGAAGG + Intronic
911283875 1:95965597-95965619 GAGAGCAGAAAAGAGGAATAGGG + Intergenic
911389272 1:97218535-97218557 CAGAACAGAAAAGAGGAAAAGGG - Intronic
912698813 1:111861146-111861168 AAGGGCAGAAAGGAGGAAGGGGG + Intronic
913030485 1:114897643-114897665 GAGAGGAGATAGGAGGAAAAAGG + Intronic
913489564 1:119366265-119366287 CAGATCTGACTGGAGGAAGCGGG - Intergenic
913695128 1:121317426-121317448 CACAGCAGAAAGGAGGCAAATGG - Intronic
914142435 1:144962634-144962656 CACAGCAGAAAGGAGGCAAATGG + Intronic
914344387 1:146785942-146785964 CAGAGAAGACTGGAGCAGGAAGG - Intergenic
914437496 1:147672651-147672673 CAGACCAGAGAGGAGAAAGAAGG - Intergenic
914665923 1:149832499-149832521 CTGAGCAGAGTGGAGGAGGAGGG + Intergenic
914669842 1:149861295-149861317 CTGAGCAGAGTGGAGGAGGAGGG - Intronic
914787006 1:150842633-150842655 CAGAGAAGAGAGGAGGGAAATGG + Intronic
914807619 1:151003015-151003037 GAGAGCACAAAGGAGAAAGAAGG + Intronic
914899373 1:151703636-151703658 TAGAGGAGACAGGAGGGAGGGGG + Intronic
915459009 1:156058540-156058562 CAGAGAAGATAGGAAGAAGCAGG + Intergenic
915474319 1:156144184-156144206 CAGAGCAGACTGGGGGTAGGTGG - Intergenic
915625876 1:157113819-157113841 CAGGGAAGACAGGAGCAGGAAGG - Intergenic
915731260 1:158056076-158056098 CAGGGCAGAAGGGAGGAAGCAGG - Intronic
915944819 1:160141896-160141918 CTGGGCAGACAGGTGGGAGATGG + Exonic
916637000 1:166682209-166682231 CAGCACAGACTAGAGGAAGAAGG - Intergenic
917526982 1:175796804-175796826 AAGAACAGACAGGACAAAGAAGG - Intergenic
917562095 1:176168820-176168842 AAGGGAAGTCAGGAGGAAGAGGG + Intronic
918246539 1:182665198-182665220 CAGAGCAGGGTTGAGGAAGAGGG - Intronic
918714690 1:187770692-187770714 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
919411998 1:197257239-197257261 CAGAACAAAAAGGTGGAAGAAGG - Intergenic
919440016 1:197621097-197621119 GAGATCAGACTGGAGGAAGTGGG + Intronic
919972439 1:202589960-202589982 GAGAGGAGACAGGTGGAAGTGGG + Exonic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920206959 1:204299246-204299268 GAAAGCAAACAGGAGGAAGAAGG + Intronic
920438207 1:205961748-205961770 TACATCAGACAGGAGGCAGATGG - Intergenic
920482461 1:206335809-206335831 CACAGCAGAAAGGAGGCAAATGG - Intronic
921056331 1:211545295-211545317 AAGAGCAGAGTGAAGGAAGAGGG - Intergenic
921097021 1:211895462-211895484 AACAGCAGAGAAGAGGAAGAGGG - Intergenic
921176457 1:212599557-212599579 CAGAGGAGAGAGGAGAGAGAGGG - Intronic
921463875 1:215462037-215462059 AGCAGCAGACAGGAGGAAGCAGG + Intergenic
922252623 1:223863911-223863933 CATAGCGGACAGGATGCAGAAGG - Intergenic
922353009 1:224750286-224750308 CATGGGAGACAGAAGGAAGAGGG - Intergenic
922565323 1:226597819-226597841 CAGAGATCACAGGAGGAAGTGGG + Intronic
922566913 1:226607039-226607061 CAGAGCTCTCAGGAGGGAGAAGG - Exonic
922707575 1:227797316-227797338 AAGAGGACACAGGAGGAAGGTGG + Intergenic
922790154 1:228306778-228306800 CAGAGCAGCTACGAGGAAGGAGG - Intronic
922891814 1:229067562-229067584 GAAAGCAGACAGGGGGGAGAAGG - Intergenic
923079577 1:230640985-230641007 CAGAGGAGACAGGTTGATGATGG + Intergenic
923295000 1:232585653-232585675 AAGAGAACAAAGGAGGAAGAAGG + Intergenic
923600416 1:235397996-235398018 CAAAGCAGACAGAAGGAGCAAGG - Intronic
924181312 1:241441109-241441131 GAGAGAAGACAGGATGTAGAGGG - Intergenic
924440602 1:244082362-244082384 AAGTGAAGACAGGAGGAAGTGGG + Intergenic
1063022797 10:2146551-2146573 CACAGCAGACATCAGGAAGCAGG - Intergenic
1063082457 10:2781697-2781719 CAACACAGACAGCAGGAAGATGG + Intergenic
1063180771 10:3597703-3597725 GAGAGAAGACAGAAGGAAAAGGG + Intergenic
1063451762 10:6154787-6154809 CAGATCAGACAGAAGGCAGCTGG - Intronic
1064063274 10:12157999-12158021 CAGGGCCGACTGGAGGATGATGG - Exonic
1064209632 10:13351340-13351362 CAGAGGAGACACAGGGAAGATGG + Intergenic
1064250810 10:13705086-13705108 CTGAGAAGACAGGCAGAAGAAGG - Intronic
1064544990 10:16441030-16441052 CAAAGCAGACTGGAGCATGATGG - Intronic
1065077866 10:22098825-22098847 CAGAGGGGTCAGGAGCAAGATGG + Intergenic
1065397654 10:25257143-25257165 CACAGCAGAAAGGGAGAAGATGG + Intronic
1065862966 10:29886839-29886861 CAGACCAGAGAGGAAGGAGATGG + Intergenic
1065879609 10:30027509-30027531 CACTGCAGACAGGAGGATGTGGG - Exonic
1066111427 10:32200531-32200553 CAGAGAAGAGGGGAGGATGAGGG + Intergenic
1067030358 10:42875476-42875498 CAGGGAAGGCTGGAGGAAGAGGG - Intergenic
1067344775 10:45429191-45429213 GAGATGAGGCAGGAGGAAGAGGG + Intronic
1067562102 10:47311357-47311379 CAGAGCAGGCTGCAGGGAGAGGG - Intronic
1067748662 10:48955874-48955896 CAGAGCACACATGTGGAACAAGG - Intronic
1067927448 10:50524447-50524469 AAGAGAAGAAAGGAGGAAAAGGG - Intronic
1068082369 10:52335368-52335390 CAGGGGAGACAGGATGAAGCAGG + Intergenic
1069729760 10:70602946-70602968 CAGGGCACACAGGCGGAGGAGGG + Intergenic
1069821256 10:71230074-71230096 AAGAGCAGAGAGGAGGAGGTAGG - Intronic
1069957443 10:72060693-72060715 GAGAGAGGACAGGAGAAAGAGGG + Exonic
1070161307 10:73868258-73868280 CAGAGGAAGCAGCAGGAAGAAGG + Intronic
1070458439 10:76641539-76641561 AACAGAAGACAGGAGGAAAAGGG - Intergenic
1070652641 10:78249013-78249035 CACAGCACACAGGAGGAAGGAGG - Intergenic
1070828343 10:79404024-79404046 CAGAGCAGATAAGAGGAGAAGGG + Intronic
1071186841 10:83056234-83056256 AAGACAAAACAGGAGGAAGAAGG - Intergenic
1071752472 10:88496062-88496084 CAAAGGGGACAGAAGGAAGAGGG + Intronic
1072144604 10:92623346-92623368 CAGAGAAAACAAGGGGAAGAAGG + Intronic
1072899553 10:99394959-99394981 CAAAGCAAACAGGAGGATCAGGG + Intergenic
1073146760 10:101286202-101286224 CTGAGCAGATAGGAAAAAGAGGG - Intergenic
1073429864 10:103479086-103479108 CACAGCAGACACCAGGAAGGTGG - Exonic
1074018232 10:109557494-109557516 CAGAGCTTGCAGGAGGAAGTAGG - Intergenic
1074115573 10:110455463-110455485 CACAGCAGACAGAAGGTACAAGG - Intergenic
1074358594 10:112807151-112807173 CAGTGCAGCCATGGGGAAGAAGG + Intronic
1074498847 10:114004195-114004217 AAGAGAAGACAGGATGGAGAAGG - Intergenic
1074512432 10:114127954-114127976 CAAAGCAGAGAGGAGGAGGAAGG + Intronic
1074754922 10:116617260-116617282 CCGAGCAGAGAGTAAGAAGAAGG + Intergenic
1074872925 10:117591310-117591332 CAGAGAAGACAAGGGAAAGAAGG - Intergenic
1074940587 10:118232743-118232765 CTCAGAGGACAGGAGGAAGAGGG + Intergenic
1074998660 10:118779217-118779239 TAGGTCAGAGAGGAGGAAGACGG - Intergenic
1075067248 10:119297439-119297461 CAGAGCAGCCTGGTGGAGGATGG - Intronic
1075089330 10:119434647-119434669 GAAAGCAGCCAGGAGGGAGACGG - Intronic
1075680680 10:124329009-124329031 CTGAGCAGCCAGGAGAAACACGG + Intergenic
1075702435 10:124478126-124478148 CAGAGGAGGCAGGAGGAGGGAGG + Intronic
1075787581 10:125060645-125060667 CAGGGCAGTCATGCGGAAGAGGG + Intronic
1076012632 10:127002804-127002826 CAGTCCAGACAGGAGGAACCAGG - Intronic
1076121419 10:127939868-127939890 AGGAGGAGACAGGAGGAAGCAGG + Intronic
1076273167 10:129174488-129174510 CAGAGCAGAAAGAAGGAGGCAGG - Intergenic
1076588923 10:131570150-131570172 CAGAGATGAAAGGAGGAGGAGGG + Intergenic
1076686219 10:132199602-132199624 CAGTGCGGACAGCAGGAGGAGGG - Intronic
1078103508 11:8343995-8344017 CAGAGCGGACTGCTGGAAGAAGG - Intergenic
1078392108 11:10944221-10944243 AACAGCAGACAGCAGGAAGTAGG - Intergenic
1079005461 11:16788746-16788768 CAGAGAGGAGAGGAGGAAGATGG - Exonic
1080186521 11:29493846-29493868 CAAAGAAGACAGAAGGAAGAGGG - Intergenic
1080676418 11:34432014-34432036 CAGAGCAGCAAGGATGAAGGAGG - Intergenic
1080878909 11:36301198-36301220 CAGAAGAGGGAGGAGGAAGAAGG + Intronic
1080938551 11:36887656-36887678 CAGACCAGACATGCGGAAAATGG + Intergenic
1081482673 11:43504229-43504251 GAGAACAGAAAGGAGGAGGAAGG - Intergenic
1081806011 11:45890929-45890951 CTGAGCAGAGGGCAGGAAGATGG + Intronic
1083320493 11:61842961-61842983 CAGTGCAGCCAACAGGAAGAAGG - Intronic
1083526809 11:63374911-63374933 CAAAGCTGATAGAAGGAAGATGG - Intronic
1083709056 11:64536492-64536514 CAGAGCAGAAGGGATCAAGAGGG - Intergenic
1083712785 11:64559342-64559364 CAGAGGAGGCAGGAGGGAGACGG - Intronic
1084495616 11:69501469-69501491 GAGGGCTGAAAGGAGGAAGATGG + Intergenic
1084582523 11:70032805-70032827 CAGAACACATAGGAGGAGGAGGG + Intergenic
1084717434 11:70882905-70882927 CAGGGCAGGCAGGAGGCAGGTGG + Intronic
1085248928 11:75128735-75128757 GAGAGCACACAGCAGGAAGCTGG - Intronic
1085645389 11:78219164-78219186 CAGAGTAGAGAGGAGGTGGATGG + Exonic
1085777951 11:79383061-79383083 CAGGGCAGAAAGGCAGAAGATGG - Intronic
1086295615 11:85364337-85364359 CAGAGCAGACTGGAGTACCAGGG + Intronic
1087070938 11:94079831-94079853 CAGAGCATGCAGCAGGATGAAGG + Intronic
1087081291 11:94173477-94173499 CAGAGCAGACGGGAGTGAGGTGG - Intronic
1087653752 11:100898834-100898856 CAGAGCAGAAATGAAGGAGATGG - Intronic
1087666361 11:101053624-101053646 GAGGGAAGAAAGGAGGAAGAAGG - Intronic
1087666374 11:101053672-101053694 GAGAGAAGAAAGGAGGGAGAAGG - Intronic
1087897023 11:103597520-103597542 CAGAGTAGACAGAAGGAAACAGG - Intergenic
1088843184 11:113643776-113643798 AAATGCAGAGAGGAGGAAGAAGG - Intergenic
1088846310 11:113671269-113671291 GAGACCAGACAGAAGGAAGGTGG - Intergenic
1088880789 11:113971863-113971885 CACAACAGACAGGGGGAAGCTGG - Intergenic
1088938999 11:114434973-114434995 CAGAAAAGACAGGAAGATGAGGG - Intronic
1089069699 11:115689875-115689897 CAGCGGAGACATGAGGGAGAAGG + Intergenic
1089099112 11:115945980-115946002 CTGAGCAGACAGGAGAGAGAAGG + Intergenic
1089353318 11:117833717-117833739 CAGAGCAGCCAGGAACAAGGTGG + Intronic
1089460856 11:118652691-118652713 CAGAGAAGAGGGGAGGGAGAGGG + Intronic
1089558868 11:119333414-119333436 CAGGGCAGACTGAAGGAGGACGG + Intergenic
1089763985 11:120749654-120749676 GAGGACAGACAGCAGGAAGATGG + Intronic
1090639307 11:128716891-128716913 CAGTGCAGGGAGGAGGAAGAAGG + Intronic
1090705207 11:129329878-129329900 GAGAGGAGAGAGCAGGAAGAGGG + Intergenic
1090961415 11:131560904-131560926 CAGAGCTGACTTGAAGAAGAGGG - Intronic
1091217052 11:133908521-133908543 CAGTGGAGGCAGGAGGAGGAGGG - Intergenic
1091629344 12:2147616-2147638 CAGAACTAACTGGAGGAAGAGGG + Intronic
1092443618 12:8532195-8532217 CAGAGGAGAAAGGAGGAAGAAGG + Intergenic
1093268289 12:17026861-17026883 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1094466850 12:30762501-30762523 CAGAGGAGACACAGGGAAGAAGG + Intergenic
1095397248 12:41775091-41775113 GAAAGCAGCCAGGAGGATGAAGG - Intergenic
1095724255 12:45434674-45434696 CAGAGCAGAAATGAGGGACAGGG - Intronic
1095912052 12:47437738-47437760 CAAAGCAAACAGAAGGAAGGAGG + Intergenic
1096245754 12:49984812-49984834 CAGAGCACACAGGATGCACAGGG + Intronic
1096368016 12:51044989-51045011 CAGAGAAGATAGAAGGAAGCTGG + Intergenic
1096870813 12:54590933-54590955 CGGAGGAGAGAGGAGGGAGAGGG + Intergenic
1097956921 12:65495699-65495721 CAGGGCAGTCAAGAGGAAGTGGG - Intergenic
1098394420 12:70003088-70003110 CAGAGGAGAGAGGAGGAGGGAGG + Intergenic
1099843775 12:88002961-88002983 TAGCACAGAAAGGAGGAAGAGGG - Intronic
1099904321 12:88754021-88754043 CAGAGGCCACAGGAGGAGGATGG + Intergenic
1101319581 12:103661777-103661799 CAGAGCAGAAAGGAGCATGCTGG + Intronic
1101353421 12:103954744-103954766 GTGAGCAGACAGGAGAAAGGAGG + Intronic
1102159940 12:110760415-110760437 CTGTGAAGACAGGTGGAAGACGG + Intergenic
1102214050 12:111147645-111147667 GAGAGGAGACAGGATGAAGATGG + Intronic
1102451522 12:113045167-113045189 GAAAGAAGAAAGGAGGAAGAAGG + Intergenic
1102647451 12:114413104-114413126 CTGAGCAGTCAGGAGAAAGATGG - Intergenic
1102756149 12:115342534-115342556 GAGAGCAGGGAGGAGGGAGAAGG + Intergenic
1103059642 12:117848198-117848220 AACAGCAGAGAAGAGGAAGAAGG + Intronic
1103135854 12:118507017-118507039 CAGAGCAGAAGGGAGAGAGAGGG - Intergenic
1103164501 12:118758435-118758457 TAGAGCAGAAAAGAGGAACAAGG + Intergenic
1103239785 12:119403599-119403621 CAGAGGGCACAGGGGGAAGATGG - Intronic
1103325430 12:120116959-120116981 CCGAGGAGACGCGAGGAAGACGG - Intronic
1103478193 12:121233587-121233609 AAGAACAGAGAGGAGGAGGAGGG + Exonic
1103871235 12:124093761-124093783 CAGGGAAGGCAGCAGGAAGAGGG + Intronic
1103881125 12:124166782-124166804 AAAAGCAGAGAGGAGGGAGAAGG + Intronic
1103967157 12:124647072-124647094 GAGGGCAGACAGGAGGAAGTAGG + Intergenic
1104082761 12:125445492-125445514 CAGAGGACACTGGAGGAACATGG + Intronic
1104373607 12:128245256-128245278 CAGAGGAGACAAGAGGATGTGGG - Intergenic
1104384862 12:128341927-128341949 GAGAGAAGACAGCAGGAAGCAGG - Intronic
1104416665 12:128601461-128601483 CAGAGAAAGGAGGAGGAAGATGG + Intronic
1104606566 12:130193737-130193759 CAGGGTAGAAAGGATGAAGACGG - Intergenic
1104690081 12:130819048-130819070 CAGGGCAGAGAGGTGGACGAAGG - Intronic
1104742445 12:131188477-131188499 CAGAGCAGCCACCAGGAACAGGG - Intergenic
1104769877 12:131354765-131354787 AAGAGCAGAAAGGAGGCTGAGGG + Intergenic
1105410260 13:20165914-20165936 CAGAGAAGGCAGGAGGAGCAGGG + Intergenic
1105472631 13:20706061-20706083 CAGAGTAGCCAGGAGGCAGGAGG - Intronic
1105542671 13:21328297-21328319 CTCAGCAGGCAGGAGGTAGAAGG - Intergenic
1105579815 13:21684788-21684810 CAGAGAAGACTTGAGAAAGAAGG - Intronic
1105899399 13:24742581-24742603 CAGAGCAGACAGGAGCAGGAGGG - Intergenic
1106042940 13:26111234-26111256 TAGAGGAGGAAGGAGGAAGAGGG - Intergenic
1106191593 13:27458341-27458363 GCCAGCAGAAAGGAGGAAGAGGG - Intergenic
1106602424 13:31199725-31199747 CAGAGGAGAAAGGAAGAGGAGGG + Intergenic
1107145778 13:37059440-37059462 CAGAGCCCGCTGGAGGAAGACGG - Intronic
1107347990 13:39483698-39483720 CAATGCAGAGAGGAAGAAGATGG + Intronic
1107361015 13:39618065-39618087 AAGAAGAGAGAGGAGGAAGATGG + Intergenic
1108204198 13:48071821-48071843 AAGAGAGGACAGGAGGAAAAAGG - Intronic
1108243661 13:48493398-48493420 CACAGCAGCCAGGAGGCAGGAGG + Intronic
1108845932 13:54678526-54678548 CAGATCATACAGGAGGGTGAGGG - Intergenic
1108998537 13:56765529-56765551 AAGATCAGAAAAGAGGAAGAAGG + Intergenic
1109327889 13:60891652-60891674 CAGAGCAGAGCTGAGGAAGATGG - Intergenic
1109478759 13:62919738-62919760 CAGAGCAGACACCAGGAGCAGGG + Intergenic
1109709947 13:66146533-66146555 CAGAGCAAAAAGGAGGAGGACGG + Intergenic
1110593490 13:77292257-77292279 CAGAGCAAGCAGCAGGAAAAAGG - Intronic
1112264804 13:97913590-97913612 GAGAGGACACAGGAGAAAGATGG - Intergenic
1112298601 13:98210482-98210504 CAGGGCAGAAGGGAGGAAGTAGG - Intronic
1112342536 13:98564529-98564551 AAGAGCAGAGAGGAGGAAGCTGG + Intronic
1112667542 13:101593748-101593770 CAGAGACGGGAGGAGGAAGATGG + Intronic
1113084686 13:106556030-106556052 CAGTGCAGATAGGAAGAAGAGGG - Intronic
1113537860 13:111082377-111082399 CAGGGCAGCCAGGAGGACGCTGG - Intergenic
1113738716 13:112696647-112696669 CAGAAGAGACAGGAGAAGGAAGG - Intronic
1114287930 14:21262746-21262768 CAAGGGAAACAGGAGGAAGATGG + Intronic
1114530966 14:23396264-23396286 CAGGTGAGACAGGAGGAAAAGGG - Exonic
1114531471 14:23399217-23399239 CTGGGCAGAAAGGAGGAGGAAGG - Intronic
1114552115 14:23538721-23538743 AAGAGGAGGAAGGAGGAAGAGGG + Intronic
1114552664 14:23542325-23542347 GGGAGCAGACAGGAGGAGAAGGG + Intronic
1115067465 14:29282057-29282079 GAGAGAAGACAGGTTGAAGAGGG - Intergenic
1115843939 14:37504755-37504777 CAGAGCAGAACTGAAGAAGATGG + Intronic
1115892538 14:38047422-38047444 CAGAGGAAACAGGAAGAAGTTGG - Intergenic
1116268230 14:42724520-42724542 GAGAGAAGCCAGTAGGAAGAAGG - Intergenic
1117244432 14:53870166-53870188 CAGAGGAAGCAGGAGGAAGTGGG + Intergenic
1117659087 14:57985642-57985664 GAGAGCAGGCAGGAGCAAGCTGG - Intergenic
1117667319 14:58070200-58070222 CAGCTCAAAGAGGAGGAAGAAGG + Intronic
1118367063 14:65104960-65104982 AAGAGCTCAGAGGAGGAAGAAGG + Intergenic
1118462484 14:65999596-65999618 AATAGCAGAAAGCAGGAAGATGG - Intronic
1118707199 14:68491236-68491258 CACAACAGAAAGGAGGAGGAAGG - Intronic
1118730516 14:68662891-68662913 CAGAGCAGTGGGGAGGAGGATGG - Intronic
1118952283 14:70445825-70445847 CAGAGGACAGAGGAGGAAAAAGG + Intergenic
1119316864 14:73703820-73703842 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1119477753 14:74940998-74941020 CAAAGCACTGAGGAGGAAGACGG + Intergenic
1119487842 14:75003297-75003319 CAGAGAGGGCAGGAGGATGACGG + Exonic
1119575273 14:75715295-75715317 CAGGGCCCACATGAGGAAGATGG - Intronic
1119760317 14:77146246-77146268 CAGAGCACGCAGGAGGCAGAGGG + Intronic
1119930893 14:78545167-78545189 CAGAACTGACAGGAGCAATAGGG + Intronic
1120064445 14:80024055-80024077 CAGAGCAACCAGGAAAAAGAGGG - Intergenic
1120129990 14:80795322-80795344 CAGATAACACAGAAGGAAGAGGG - Intronic
1120484773 14:85099294-85099316 AAGAGAAGAGAGGAGAAAGATGG + Intergenic
1120500505 14:85291123-85291145 CAGAGCAGACAGGCATCAGAGGG + Intergenic
1120942602 14:89963196-89963218 CAGAGAAGAGAAGAGGTAGATGG - Exonic
1121117711 14:91355258-91355280 CAGCGCAGACACGGGTAAGAGGG + Intronic
1121699356 14:95940661-95940683 GAAAGCTGACAGGAGGAGGAGGG - Intergenic
1122128076 14:99589958-99589980 CTGAGCAGGAAGGAGGCAGAGGG - Intronic
1122355407 14:101120257-101120279 CAGAACAGACAGGAGGAGCATGG + Intergenic
1122895651 14:104755517-104755539 GAGGGCACACAGGAGGACGATGG + Intronic
1202905142 14_GL000194v1_random:67288-67310 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1123992549 15:25694338-25694360 CACAGCTGACAGGAGGCAGTGGG + Intronic
1124158639 15:27250044-27250066 AAGAACAGACAGGAGGATGGAGG - Intronic
1124479172 15:30062771-30062793 AAGAAAAGACAGAAGGAAGAAGG + Intergenic
1124877108 15:33605359-33605381 CAGAGGAGACAGGAGGGATGAGG - Intronic
1125145995 15:36469003-36469025 CAGACCAGACAGAGGGAAGGAGG + Intergenic
1125245836 15:37638045-37638067 CAGAGCAAACAGAAGGGAGGAGG + Intergenic
1125448946 15:39787814-39787836 CACAGCAGACAGGGAGAGGAGGG - Intergenic
1126273171 15:46845653-46845675 CAGAAAAGACAGGAGGATGTGGG - Intergenic
1126445241 15:48735783-48735805 TAAAGCAAACAGAAGGAAGAGGG + Intronic
1126702060 15:51377405-51377427 CAGAGCAGACAGTGGGCAGCAGG - Intronic
1127360875 15:58244221-58244243 GAGAAGAGACAGGAGGAAGTGGG - Intronic
1127631416 15:60831288-60831310 CAGAACAGCCAGGACAAAGATGG + Intronic
1128147404 15:65339611-65339633 CTGAGCAAACATGAGGAAGTGGG + Intronic
1128535371 15:68486210-68486232 CAGAGCAGGGAGGAGAAAGGTGG + Intergenic
1128544954 15:68560683-68560705 AGGAGCAGAGAGGAGGAAGATGG - Intergenic
1128551965 15:68603693-68603715 CAGAGGACACAGCAAGAAGACGG + Intronic
1128697628 15:69780470-69780492 CAGAGCTGACATCAGGAAGGAGG + Intergenic
1128816815 15:70616032-70616054 GAGACCAGACAACAGGAAGATGG - Intergenic
1129039173 15:72670884-72670906 CAGTGCAGACAGGAGAAGGAGGG - Intergenic
1129272848 15:74428582-74428604 CTGGGCAGAAAGGAGGAGGAGGG + Intronic
1129337137 15:74859398-74859420 CAGAGCAAAAAACAGGAAGAAGG + Intronic
1129599590 15:76990729-76990751 GAGAGCAGACAGGAGTGAGCAGG + Intergenic
1129790426 15:78337460-78337482 CAGAGCAGACAGGAGGGGCCAGG - Intergenic
1130209534 15:81910510-81910532 GAGAGCAGAAGGGAGGGAGAAGG + Intergenic
1131217149 15:90547677-90547699 GAGGGCAGAGAGGAGGAAGTGGG + Intronic
1132221795 15:100110718-100110740 AAGAGCAGCAAGGAGGATGAAGG - Intronic
1132468789 16:90252-90274 CAAAGAAGAGAGGAGGCAGAGGG - Intronic
1132565374 16:620037-620059 TGGAGCAGGCAGGTGGAAGACGG + Intronic
1132919584 16:2379363-2379385 CAGAGCACACAGCAGCACGAAGG - Intergenic
1133234069 16:4379568-4379590 CAGGGCAGACAGAAGAAAGCAGG - Intronic
1133235748 16:4386630-4386652 CAGAGCAGGCAGGAGGCTGAGGG + Intronic
1133583685 16:7170990-7171012 GTGAGCAGACTGGAGCAAGACGG - Intronic
1134340859 16:13344439-13344461 AAGGGCATAGAGGAGGAAGAAGG - Intergenic
1134455658 16:14393442-14393464 CTGAGAAGACAGGAGGAACCTGG - Intergenic
1134692051 16:16197562-16197584 GGGAGCAGAAAGGAAGAAGAAGG + Intronic
1134904842 16:17971529-17971551 AAGAAGAGACAGGAGAAAGATGG + Intergenic
1134912251 16:18038199-18038221 CTTAGCAAACAGGAGGAAAAGGG - Intergenic
1135017606 16:18936838-18936860 CAGAGCTGAATGGAGAAAGATGG - Intergenic
1135893991 16:26381929-26381951 CTGAGGACACAGGAGGAAGCAGG - Intergenic
1136066142 16:27760175-27760197 CAGAGCAGGCAGAAGGAAGCAGG - Intronic
1136513820 16:30756052-30756074 GAAGGCAGACAGAAGGAAGATGG + Intronic
1136922739 16:34345578-34345600 CTGAGCAGACAGGAGTAGGAGGG + Intergenic
1136981834 16:35066228-35066250 CTGAGCAGACAGGAGTAGGAGGG - Intergenic
1137611875 16:49823672-49823694 CAGAGGAGACAGTAAGAGGAAGG + Intronic
1137675905 16:50303838-50303860 AGAAGCAGCCAGGAGGAAGAGGG - Intronic
1137863035 16:51865969-51865991 CAGAGTTGACAAGAGGAAGGAGG - Intergenic
1138554387 16:57763331-57763353 CAGGCCAGGCAGGAGGAGGAAGG - Intronic
1138849039 16:60604785-60604807 CATGGCAGGCAGGAGGAAGAGGG + Intergenic
1139099949 16:63753631-63753653 GATAGCAGAAAGGAGGAATAAGG + Intergenic
1139213232 16:65101543-65101565 AAGAGAAGAAGGGAGGAAGAAGG - Intronic
1139614915 16:68083140-68083162 CAGACCAGACAGCAGGCAGGAGG - Intergenic
1139671836 16:68497491-68497513 CAGAGCAGAAAGGAGGCAGCAGG - Intergenic
1139872411 16:70118189-70118211 AAGAGAAGAGAGGAGGAAGTGGG + Intronic
1139989610 16:70929407-70929429 CAGAGAAGACTGGAGCAGGAAGG + Intronic
1140031210 16:71340696-71340718 CTGAGCAGACAGGAGGTGGGAGG - Intergenic
1140109951 16:71995419-71995441 TAGGGCAGAAAGGATGAAGATGG - Intronic
1140363360 16:74363106-74363128 AAGAGAAGAGAGGAGGAAGTGGG - Intergenic
1140588200 16:76319685-76319707 CAGAGTAGACCAGATGAAGATGG + Intronic
1140684748 16:77422609-77422631 GAGAGAAAAAAGGAGGAAGAAGG + Intronic
1141623285 16:85248390-85248412 CAGAGGAAACAGAAAGAAGAGGG - Intergenic
1141643980 16:85357601-85357623 CAGAGCAGCCGGGAGGAGGACGG + Exonic
1141829481 16:86501749-86501771 CAGAGCTGACATGAGGACCAGGG - Intergenic
1142001281 16:87665718-87665740 CGGGGCAGCCGGGAGGAAGAGGG - Intronic
1142105919 16:88302725-88302747 CAGAGCAGCCAGCAGGGACAGGG - Intergenic
1142404910 16:89882970-89882992 TTGAGGAGAAAGGAGGAAGAAGG + Intronic
1142612259 17:1115567-1115589 TAGAACAGAGAGGAGGCAGAGGG - Intronic
1142637568 17:1267721-1267743 CCAAGCAGACAGGAGGTAGAGGG - Intergenic
1142851038 17:2704898-2704920 CAGAGAAGAGGAGAGGAAGAGGG - Intronic
1142930851 17:3282992-3283014 GAGAGCAGAAGAGAGGAAGAAGG - Intergenic
1143065924 17:4247222-4247244 GAGAGCAGAGAGGGGGAAGATGG - Intronic
1143222936 17:5277590-5277612 CAGAGCTGACCAGAGCAAGAAGG - Intergenic
1143356668 17:6334815-6334837 GACAGCAGGAAGGAGGAAGAAGG + Intergenic
1143794696 17:9327240-9327262 CAGAGGAGGAAGGAGGAAGGAGG + Intronic
1144046908 17:11462174-11462196 CAGAGAGGACAGAAGCAAGAGGG - Intronic
1144063328 17:11602482-11602504 TAGAGCAGCAAGGAGGAACAAGG - Intronic
1144886302 17:18464923-18464945 CAGAGAAGAGATGAGGAAGCAGG - Intergenic
1145145903 17:20479388-20479410 CAGAGAAGAGATGAGGAAGCAGG + Intergenic
1145398884 17:22515553-22515575 AAGAGGAGAAAGAAGGAAGAAGG + Intergenic
1145727161 17:27140809-27140831 AAGAGGAGAAAGGAGGAGGAAGG - Intergenic
1146648363 17:34590438-34590460 CAGAGCATTGTGGAGGAAGAGGG + Intronic
1146741258 17:35285736-35285758 CAGAGCAGGCTGGAGAAGGATGG - Intergenic
1146941210 17:36845579-36845601 CAGTGCTGAGAGGAGGAAGGTGG + Intergenic
1147165689 17:38592054-38592076 CAGGGCAGGGAGGAGGAAGTAGG - Intronic
1147454801 17:40530592-40530614 GAGAGCAGGCTGGAGGGAGATGG - Intergenic
1147970129 17:44214888-44214910 CAGATGGGACACGAGGAAGATGG - Intronic
1148117190 17:45183087-45183109 CAGAGCAGAGGTGGGGAAGAAGG + Intergenic
1148322409 17:46765540-46765562 CAGTGCAGGCAGGAGAGAGAAGG - Intronic
1148546382 17:48522319-48522341 CAGAGCCAACAGGAGGAGGCTGG + Intergenic
1148559362 17:48597203-48597225 CAGAGGAGGGAGGAGGAATAAGG - Intronic
1148598770 17:48878262-48878284 CAGAGCCCTCAGCAGGAAGAGGG + Intergenic
1148683276 17:49486708-49486730 CACAGCACACAGGAGGCAGCAGG - Intergenic
1148736696 17:49869235-49869257 CTGACCAGAAAGGAGGCAGAGGG - Intergenic
1149132659 17:53323941-53323963 CTGAGGAGACAACAGGAAGAAGG + Intergenic
1149626199 17:58082817-58082839 CAAAGAACAAAGGAGGAAGAAGG + Intergenic
1149930590 17:60750779-60750801 CAGACCTGAAAGCAGGAAGATGG - Intronic
1150105649 17:62460705-62460727 GAGAGGAAAAAGGAGGAAGAAGG - Intronic
1150207442 17:63419771-63419793 CAGAGAGGCCAGAAGGAAGATGG + Intronic
1150310224 17:64122225-64122247 CAGAGCAGACAGATGGGAAAAGG - Intronic
1150437465 17:65165115-65165137 CAGAGCAGACAGGAGGAAGAAGG - Intronic
1150630112 17:66874476-66874498 CAGAGCAGAGAAGGGCAAGAAGG + Intronic
1151018317 17:70583198-70583220 GAGAGAAGACAGGAGGAATGAGG - Intergenic
1151078335 17:71299786-71299808 CATGGCGGACAAGAGGAAGAAGG - Intergenic
1151191433 17:72400869-72400891 CAGAACAAACATGGGGAAGAGGG + Intergenic
1151713165 17:75818184-75818206 CACAGCAGAGGGGAGGAAGGGGG - Intronic
1151890318 17:76947541-76947563 CAGGGCACACAGGATGCAGAGGG + Intronic
1152198189 17:78929802-78929824 CAGGACAGACAGGAGCACGAGGG + Intergenic
1152305475 17:79517943-79517965 AAGTGCAGACAGGAGGCAGCCGG + Intergenic
1152382066 17:79947229-79947251 GAGTGCAGACAGGAAGAGGAGGG - Intronic
1152663352 17:81553024-81553046 GAGAGCTGCCAGGAGGGAGAGGG - Intronic
1152805069 17:82351822-82351844 CAGAGCCGATTGGAGGAGGAGGG + Intergenic
1152805113 17:82352059-82352081 CAGAGCAGCCCGGAGGCAGCAGG - Intergenic
1153721106 18:7904405-7904427 AAGATGAGACAGGAGGGAGATGG - Intronic
1154253724 18:12765616-12765638 CAGAGCAGGCAGGAGGAGGGCGG + Intergenic
1156547881 18:37983881-37983903 CAGAGCTCACAGGAGGAAGAAGG - Intergenic
1156746009 18:40392167-40392189 CAGATCAGGCAGAAGGGAGAGGG - Intergenic
1157028828 18:43879900-43879922 AAGAGCAGTCATGAGGCAGAGGG + Intergenic
1157331708 18:46708761-46708783 CAGATCAGTAAGGAGGCAGAGGG - Intronic
1157388136 18:47277503-47277525 TAGAGCAGACAGAAGAAACAAGG - Intergenic
1157433169 18:47646921-47646943 CAGGAAAGGCAGGAGGAAGAAGG - Intergenic
1157484831 18:48079586-48079608 CAAAGCAGAGAGGATGAAGCTGG + Intronic
1157802069 18:50628733-50628755 CAGAGCCCACAGGAGGAATGTGG - Intronic
1158318534 18:56238134-56238156 ATGAGCAGACTGGAGGATGATGG + Intergenic
1158440108 18:57467911-57467933 AAAAGGAGACAGGAGGGAGAAGG - Intronic
1158588827 18:58762853-58762875 CAGGGAATACAGGAGGAAAATGG - Intergenic
1159235852 18:65671928-65671950 CACAGCAGACCTGTGGAAGAGGG + Intergenic
1159959661 18:74545653-74545675 AACAGCAGAGAGGAGGAGGAGGG - Intronic
1160111260 18:76033987-76034009 TAGAGCACACAGAGGGAAGACGG + Intergenic
1160975516 19:1790503-1790525 CAGAGGAGGGAGGGGGAAGAGGG - Intronic
1162208775 19:9075550-9075572 AAGAAAAGACTGGAGGAAGAGGG + Intergenic
1162468308 19:10856307-10856329 CAGCCCAGCAAGGAGGAAGAGGG - Exonic
1163388552 19:17015509-17015531 CAGAGCAGACAGGAGGTGGGTGG - Intronic
1163497021 19:17652535-17652557 CAGCCCAGAGAGGAGGAGGAGGG - Intronic
1163618344 19:18342659-18342681 CAGAGCGGACAGGTGCAGGACGG + Intronic
1163957342 19:20656164-20656186 CAAAGCTGACAAGAGGAATATGG + Intronic
1164049892 19:21576695-21576717 CAGACCAGTCAGGTGGAAAAGGG + Intergenic
1164567402 19:29337153-29337175 TACAGGAGACTGGAGGAAGAAGG + Intergenic
1164665757 19:30035007-30035029 AACAGCAGAGAGGAGGAATAAGG - Intergenic
1165925615 19:39324370-39324392 GAGAGAAGAAAGGAAGAAGAAGG + Intergenic
1166351636 19:42201627-42201649 CAGAGCAGAAAGGAGAATGCAGG + Intronic
1166429278 19:42710411-42710433 CTGAGAAGAAAGTAGGAAGAAGG - Intronic
1166999752 19:46738893-46738915 GAGGGCAGACAGGAGGCAAAGGG + Intronic
1167046877 19:47054903-47054925 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1167214240 19:48153881-48153903 CAGAGAAGCCAAGAGGAAGAAGG - Exonic
1167304135 19:48697017-48697039 CAGAGGGGAGAGGAGGAAGCCGG + Intronic
1167680131 19:50914632-50914654 GAGAGAAGACAGGAGGAAAGTGG - Intergenic
1167707972 19:51093109-51093131 GAGAGCACACAGGTGGAAGATGG + Intergenic
1167783877 19:51620303-51620325 CAGAAGAAACAGGAGGAAAAAGG + Intronic
1168025557 19:53641094-53641116 CAGAGGAAACAGGAGGGAAAAGG + Intergenic
925065081 2:923151-923173 CCGAACAGAAAGGAGGAGGAAGG - Intergenic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
925752427 2:7101034-7101056 AGGAGGAGACAGGAGGAAGAGGG - Intergenic
925798315 2:7570510-7570532 CAGGGCAGGCAGCAGCAAGAAGG + Intergenic
925876348 2:8314244-8314266 GAGAGCAGAAAAGAGGAAGAGGG - Intergenic
925898753 2:8493886-8493908 CAGGTCAGAGAGGAGGAAGGAGG - Intergenic
926302769 2:11616451-11616473 CTGAGGAGACAGGAGGGAGTGGG - Intronic
926590474 2:14735047-14735069 CATTCCAGGCAGGAGGAAGAGGG - Intergenic
926611465 2:14952307-14952329 GAAAAAAGACAGGAGGAAGATGG - Intergenic
926657298 2:15422097-15422119 CAGAGCACACAGGAGTTTGAGGG - Intronic
927045687 2:19275955-19275977 CAGGGCAGAGAGCAGAAAGAAGG - Intergenic
927140891 2:20130101-20130123 CAAGTGAGACAGGAGGAAGAGGG - Intergenic
927392978 2:22616314-22616336 CAGAGCAGATTGGAGAAGGATGG + Intergenic
927871795 2:26628726-26628748 CTGAGAAGACAGGAGGAGCAGGG - Intronic
927874623 2:26647280-26647302 CTGAGTAGACAGGAAGAAAAAGG + Intergenic
928092663 2:28385117-28385139 CAGGGCAGACAGCATGAGGAAGG - Intergenic
928373073 2:30755173-30755195 CAGAACTGAGAGGAGGAAGAGGG - Intronic
928706233 2:33952664-33952686 TATTGAAGACAGGAGGAAGAAGG - Intergenic
928979060 2:37119429-37119451 TAGAGGAGGCAGGAGGAACAGGG + Intronic
928997935 2:37315597-37315619 CAGAGAAAACAGGAGGTAGAGGG - Intronic
929168125 2:38904255-38904277 CAGACCAGGCAGCAGGGAGAAGG + Intronic
929693761 2:44096934-44096956 TAGAGCAGACTGTAGGAATAGGG - Intergenic
930018187 2:46985031-46985053 GAGTGCAGACAGGGGGAAGCAGG - Intronic
930376367 2:50572100-50572122 CAGAGAAAACAGGAGGACTAAGG + Intronic
930533634 2:52620357-52620379 CAGAGCATAAGAGAGGAAGAGGG - Intergenic
931376389 2:61712179-61712201 CAGAGGAGAGAGGATGATGATGG - Intergenic
931464378 2:62473854-62473876 CAGAAGAGAAAGGAGGAAGTAGG + Intergenic
931732425 2:65165132-65165154 CAGAGCAGAAAGGAGGAGCAAGG - Intergenic
931793834 2:65690552-65690574 TAGTGCAGAGAGGAGAAAGAAGG - Intergenic
931910122 2:66889917-66889939 CTGGGCAGAGAGGAGAAAGAAGG - Intergenic
932085826 2:68759095-68759117 CAGAGAAAGCAGGAGTAAGAGGG + Intronic
932452756 2:71825414-71825436 AAGTGCAAACAGGAGAAAGAAGG + Intergenic
932539411 2:72636425-72636447 AAGAGGAGGGAGGAGGAAGAAGG + Intronic
932575332 2:72959524-72959546 CTGAGCAGACAGGAGAGAGTAGG - Intronic
932747265 2:74344302-74344324 CAGAAGAGACTGGAAGAAGAGGG - Intronic
932905953 2:75751440-75751462 GAGAGAAGAGAAGAGGAAGAAGG + Intergenic
933174394 2:79159264-79159286 CAGAGCTAACAAGAGGAGGAAGG - Intronic
933951908 2:87338348-87338370 CAGTGCAGAGAGGAAGAAGCAGG + Intergenic
934029113 2:88025557-88025579 CAGAACAAAAGGGAGGAAGAAGG - Intergenic
934134150 2:88979124-88979146 CAGTGCAGAGAGGAAGAAGCAGG - Intergenic
934139087 2:89027824-89027846 CAGTGCAGAGAGGAAGAAGCAGG - Intergenic
934145158 2:89085831-89085853 CAGTGCAGAGAGGAAGAAGCAGG - Intergenic
934224094 2:90114724-90114746 CAGTGCAGAGAGGAAGAAGCAGG + Intergenic
934236150 2:90234682-90234704 CAGTGCAGAGAGGAAGAAGCAGG + Intergenic
934501492 2:94863186-94863208 CAGGTCAGACAGGTGGAGGAGGG - Intergenic
934717423 2:96551858-96551880 AAGCGCAGCCTGGAGGAAGAGGG + Exonic
934818188 2:97348472-97348494 CAGTGCAGACAGGAGGAGGCAGG + Intergenic
934948273 2:98557912-98557934 CAGAGTGTACAGGAGGAAGGCGG - Intronic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
935749576 2:106219420-106219442 AGGAGCAGAAAGAAGGAAGAGGG + Intergenic
935757052 2:106284442-106284464 CAGAGCAGACACAGGGAAGCTGG - Intergenic
936073878 2:109389291-109389313 CTGTGCAAACAGGAGGAAGAGGG + Intronic
936112509 2:109676546-109676568 CAGAGCAGACACAGGGAAGCTGG + Intergenic
936121722 2:109751897-109751919 AGGAGCAGAAAGAAGGAAGAGGG - Intergenic
936222973 2:110619575-110619597 AGGAGCAGAAAGAAGGAAGAGGG + Intergenic
936378788 2:111965841-111965863 CAGAGGAAACAAGAGGAAGAGGG - Intronic
936514684 2:113174226-113174248 CAGAGCAGGAAGGGGGAAGGAGG - Intronic
936715799 2:115186564-115186586 AACAGCAGATAGGACGAAGAAGG + Intronic
936760726 2:115778019-115778041 CAGAGCAGGAAGGAGCAAGCAGG - Intronic
936870350 2:117129181-117129203 GAGAGAAGAGAGAAGGAAGAAGG - Intergenic
937039217 2:118807998-118808020 CAGAGTGGGCAGGAGGGAGAGGG + Intergenic
937123272 2:119455457-119455479 CAGACCATACAGGAAGCAGAAGG + Intronic
937221484 2:120345245-120345267 CAGAAGAGACAGGAGCGAGAAGG + Intergenic
937227164 2:120376503-120376525 CAGAGGAGAAGGGAGGAAGGAGG - Intergenic
937259243 2:120574884-120574906 CAGAGCAGACACCTGGATGAAGG - Intergenic
937551255 2:123095254-123095276 AAGAGCAGACAGGCAGGAGATGG - Intergenic
937784049 2:125874341-125874363 CAGAGCTGGGAGGAGGCAGACGG + Intergenic
937826686 2:126374315-126374337 CAGAGCAGACAGCCCGAATAAGG + Intergenic
938195436 2:129323419-129323441 TAGAACAAAAAGGAGGAAGAAGG - Intergenic
939257785 2:139766696-139766718 CAGTGCAGGCAGAAGGAAGTGGG + Intergenic
939295641 2:140260787-140260809 CAGAGCAGAAAAGAGGGATATGG - Intronic
939738900 2:145881857-145881879 GAGAGCACACTGGGGGAAGATGG + Intergenic
939862483 2:147436464-147436486 CAGAGCAGTGAGGAAGAACATGG + Intergenic
940667852 2:156630976-156630998 CAGGGCAGTCAGGAGGCAGACGG + Intergenic
941615885 2:167718809-167718831 CAGGGGAGAAAGGAGGGAGAAGG + Intergenic
941641389 2:167992438-167992460 CAGAGCAGAAAGAAGGATGTGGG + Intronic
942435994 2:175977010-175977032 AAGAGCAGACATGAGGGAGTGGG + Intronic
942449734 2:176101288-176101310 CAGGGCAGACAGGAGGGTGGAGG - Intergenic
942709341 2:178815007-178815029 ATGTGGAGACAGGAGGAAGATGG + Intronic
943874209 2:193041745-193041767 CAGAGAAGTCAAGAGGAAAAGGG - Intergenic
944046699 2:195419951-195419973 CAGAGGAGACAGGATAATGATGG - Intergenic
944120893 2:196239705-196239727 CAGACCTGAAATGAGGAAGAAGG + Intronic
944770809 2:202912475-202912497 AGGAGGAGGCAGGAGGAAGACGG - Intronic
945020169 2:205562835-205562857 CAGAGAAGACAGGAGGAGGTAGG - Intronic
945398314 2:209348794-209348816 CAAAGCAGACAGCAGGAGGGAGG - Intergenic
946026238 2:216673443-216673465 CAGGGCAGGCTGGAGGAAGGAGG + Exonic
946045689 2:216819083-216819105 CAGAGCAGGAGAGAGGAAGAGGG + Intergenic
946617565 2:221526500-221526522 CTGAGCACACAGGAGAAAGGTGG - Intronic
946727183 2:222671990-222672012 CAGAGCAGGCAGGTCAAAGAGGG + Intronic
947462841 2:230318034-230318056 CAGAGCAGGAAGGAGGCAGAGGG + Intergenic
947855259 2:233319637-233319659 CAGGGCACCCAGGAGGAAGGTGG - Intronic
948091955 2:235302235-235302257 AAGAGGAGGGAGGAGGAAGAGGG - Intergenic
948098970 2:235358658-235358680 CTGAGGAGACACGGGGAAGAAGG - Intergenic
948113719 2:235477820-235477842 CTGATCAGACAGGATGAAGCAGG + Intergenic
948172997 2:235920661-235920683 TAAAGCAAACAGGAGGCAGATGG + Intronic
948209733 2:236183971-236183993 CAAAGAAGACAGGAAGATGAGGG + Intergenic
948220490 2:236265662-236265684 ATGAGCTGAAAGGAGGAAGAGGG - Intergenic
948860553 2:240750728-240750750 CACAGGAGACAGGAGGTGGAGGG + Intronic
1168805531 20:670310-670332 CAGAGCAGAAAGTAGGAGGCCGG - Intronic
1169016795 20:2298892-2298914 CCGGGCAGACAGGAGGCAGCTGG - Intronic
1169707263 20:8519493-8519515 GAGAGCAGGCAGGATGAAGAGGG - Intronic
1169997890 20:11579238-11579260 CATTGCAGAGTGGAGGAAGAGGG - Intergenic
1170044451 20:12070903-12070925 CAGAATAGACACCAGGAAGAAGG + Intergenic
1170974668 20:21150841-21150863 CTGACCTGAAAGGAGGAAGAGGG + Intronic
1171004765 20:21453663-21453685 CAGAGAAGACAGCAGGAAAGAGG + Intergenic
1171355383 20:24541477-24541499 AGGAGGAGACAGGATGAAGAGGG - Intronic
1171481761 20:25460096-25460118 CAGAGCAGACAAGAGGGATGGGG - Intronic
1171487132 20:25493434-25493456 CAGAGCCGTCAGGAGAAAGGAGG + Intronic
1172084303 20:32367681-32367703 CAGTGCAGACAGCAGCATGATGG - Intronic
1172591359 20:36120354-36120376 TAGAGCACACAGGAGGAAAAGGG + Intronic
1172874713 20:38157141-38157163 CAGAGCTGCAAGGAGGGAGATGG - Intronic
1173537882 20:43829769-43829791 CAGGGCAGACATCAGGAAAAAGG - Intergenic
1173547589 20:43910814-43910836 CAGGTCAGTCAGGAGGCAGAGGG - Intergenic
1173896169 20:46552304-46552326 CTGACCAGACAGGAGGGAGTGGG - Intergenic
1174271042 20:49368769-49368791 CAGAGTGGGCAGGAGGGAGAAGG - Exonic
1174274123 20:49391204-49391226 CAGAGCAGAAAGGTGGAATGAGG + Intronic
1174592736 20:51658981-51659003 CAGAGGGAACGGGAGGAAGATGG - Intronic
1175237271 20:57523886-57523908 CTGAGCATACAGCAGCAAGAAGG - Exonic
1175751295 20:61499735-61499757 CTGAGCAGACACCAGGAACAGGG + Intronic
1176024177 20:62977472-62977494 CAGTCCAGCCAGGAGGAAGCTGG + Intergenic
1176160386 20:63644609-63644631 CACAGCAGGCAGGAGAAGGATGG - Intronic
1176239444 20:64069148-64069170 CCCAGCAGCCAGGAGGGAGAGGG - Intronic
1176624509 21:9082043-9082065 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1176653463 21:9570408-9570430 CAGAGCAGACAGAAGGCAGGAGG - Intergenic
1177423256 21:20889823-20889845 CAAGGCAGAGAAGAGGAAGAAGG - Intergenic
1177521857 21:22237043-22237065 TAGAACAGAAAGAAGGAAGAAGG + Intergenic
1177723796 21:24941747-24941769 CAGGTCAGCCAGGAGGCAGAGGG + Intergenic
1177735763 21:25086703-25086725 CTGAGGACACAGGAAGAAGAGGG + Intergenic
1178055670 21:28796009-28796031 CAGAGAAAACAGGAGGTAGAGGG - Intergenic
1178329641 21:31676648-31676670 AAGAGTAGACAGGATGAAGGAGG - Intronic
1178612759 21:34099660-34099682 AAGAGCAGAAAGAAGGTAGAGGG - Exonic
1178615890 21:34132477-34132499 CAGAGCAGTTAGGAGGGTGAAGG + Intronic
1178873808 21:36397081-36397103 CAGGTCAGGCAGGATGAAGAGGG - Intronic
1179024855 21:37671430-37671452 ATGAGCAGCCAGAAGGAAGAAGG - Intronic
1179150164 21:38803120-38803142 CACAGAAGAGAGGAGGAAAAGGG - Intergenic
1179410139 21:41156235-41156257 CGGAGCAGAGAGGAGGATGTAGG - Intergenic
1179488921 21:41727919-41727941 CAGCGCAGACAGGAAGAGCACGG + Intergenic
1179923583 21:44520688-44520710 CAAAACAGAAGGGAGGAAGATGG - Intronic
1179939600 21:44629017-44629039 CAGACCAGACAGCAGGAAGGAGG + Intronic
1180046351 21:45307550-45307572 CAGAGAGGACGAGAGGAAGACGG + Intergenic
1180121808 21:45756689-45756711 AGGAACAGAAAGGAGGAAGAAGG - Intronic
1180175191 21:46083846-46083868 CAGAGCAGGCAGGAGTGGGAGGG + Intergenic
1180706045 22:17810584-17810606 CAGAGCAGAGCAGAGGTAGACGG - Intronic
1180898129 22:19352184-19352206 TAGAACAGGCAGGTGGAAGATGG + Intronic
1181349447 22:22244729-22244751 CAGAGCAGGGAGGAGGATGCTGG + Exonic
1181873818 22:25924266-25924288 GAAAGCAGACAGGAGGATGAAGG + Intronic
1181999052 22:26905182-26905204 TAGAGAAGAGAGGAGAAAGACGG + Intergenic
1182071147 22:27464609-27464631 CATCCCAGACAGGAGGAAGGAGG + Intergenic
1182342317 22:29633377-29633399 CAGAGGAGACAGAATTAAGAGGG - Intronic
1182847467 22:33443412-33443434 CAGTGCAGACAGGAGCAGGTGGG - Intronic
1183063771 22:35350224-35350246 CAGGGGAGCCAGGAGGGAGAGGG - Intergenic
1183073852 22:35414129-35414151 CCGAGGAGATGGGAGGAAGAAGG + Intronic
1184001164 22:41674670-41674692 CAGAGCAGACAGAAGCAGGGTGG - Exonic
1184080100 22:42213320-42213342 CAGAGCCTCCAGGAGGAGGAGGG - Exonic
1184122270 22:42459760-42459782 CAGATCAGACAGGAGGGAGGAGG + Intergenic
1184354145 22:43967336-43967358 CAGAGCAGACAGATGGAAAAGGG - Intronic
1184662844 22:45973342-45973364 CACAGCACAAAGCAGGAAGATGG + Intronic
1184792998 22:46712641-46712663 GTGTGCAGACAGCAGGAAGAAGG + Intronic
1184841636 22:47055656-47055678 CAGAGCAGCCAGCATGGAGAGGG + Intronic
1184883211 22:47325338-47325360 CTGAGCAGAAAGGTGGAAGGAGG + Intergenic
1184890106 22:47374196-47374218 GAGAGCAGACACCAGGTAGACGG - Intergenic
1184964354 22:47959001-47959023 AGGAGCAGTCAGGAGGCAGAAGG + Intergenic
1185249223 22:49791011-49791033 CAGTGCAGTCAGGAGGAGCAGGG - Intronic
1185392672 22:50571086-50571108 CCAGGCAGACAGGAGGCAGAGGG + Intronic
949091063 3:29686-29708 AAGAGCAGAGAAGAGGCAGATGG + Intergenic
949647536 3:6113743-6113765 CAAAGCTGAAAGGAGAAAGATGG + Intergenic
950090036 3:10288819-10288841 CAGACCAGTGAGGAGGAAGAGGG + Intronic
950101878 3:10362241-10362263 CAGCCCAGACAGGAAGAAGGTGG + Intronic
950234565 3:11307617-11307639 CAGAACAGAAAGTAGGTAGAAGG - Intronic
950627971 3:14262227-14262249 GACAGGAGGCAGGAGGAAGAAGG - Intergenic
950649111 3:14396298-14396320 CAGGGCAGGCAGGAGGCAGCCGG + Intergenic
950882490 3:16334591-16334613 CGGGGCATACAGGATGAAGAGGG + Intronic
950916242 3:16648086-16648108 CAGAGCAAACAGGCAGAAGAAGG - Intronic
951329404 3:21347883-21347905 CAGAGGAGAAAGGTGTAAGAAGG - Intergenic
951399337 3:22212191-22212213 GAGAAAAGACAGGTGGAAGAAGG + Intronic
951402056 3:22244982-22245004 AAGAGCAGACAAAAGGAATAAGG - Intronic
951502446 3:23403970-23403992 GGGAGAAGACAGGAAGAAGAAGG - Intronic
951643817 3:24865583-24865605 CAGGACAGAGAGGTGGAAGAGGG - Intergenic
951681026 3:25294792-25294814 AAGAAGAGAGAGGAGGAAGAGGG + Intronic
951899307 3:27641308-27641330 CAATGCAGAGAGGTGGAAGAGGG + Intergenic
952171153 3:30808168-30808190 CAGGGCAGAGAGGTGGAAAAAGG + Intronic
952181136 3:30917813-30917835 CAGAGCAGGGTGGAGAAAGATGG - Intergenic
952679216 3:36072012-36072034 CAGAGCAGAAATGAAGGAGATGG - Intergenic
952846433 3:37691410-37691432 CAGTGAAGACAGTGGGAAGATGG + Intronic
953225732 3:41017980-41018002 CAGAGAAGTGAAGAGGAAGATGG + Intergenic
953719380 3:45341965-45341987 CAGAGCAGTGAGGAGGCAAACGG + Intergenic
953928073 3:46992417-46992439 CAAAGAAGAGAGGAGGAAGATGG - Intronic
954100630 3:48369892-48369914 AAGGGCAGTCAGGAGGCAGAAGG + Intergenic
954993032 3:54857311-54857333 CAGAGCAGAGTGGAGGAAACGGG - Intronic
955753279 3:62203753-62203775 CAGACCAGACGGGCGGAAGGAGG + Exonic
956861172 3:73325305-73325327 CAAAGAAGAGAGGAGCAAGATGG - Intergenic
957430634 3:80101172-80101194 CATTGTAGGCAGGAGGAAGAAGG + Intergenic
958536608 3:95412012-95412034 GAGAGGACAGAGGAGGAAGAAGG - Intergenic
958590254 3:96149138-96149160 CACAGCACACATGAGGAAAAGGG + Intergenic
958636085 3:96749368-96749390 CAGAGCAGATATCAGAAAGAGGG + Intergenic
959254927 3:103997296-103997318 CAGTGCAGAGAGAAGGCAGAAGG + Intergenic
959354562 3:105309406-105309428 CAGAGCAGAAATGAAGGAGATGG + Intergenic
959589294 3:108059896-108059918 TAGTGAAGACAGCAGGAAGAAGG - Intronic
959784442 3:110276754-110276776 AAGAGGAGAAAGGTGGAAGAGGG - Intergenic
960167552 3:114420768-114420790 CAGAACTGAGAGGAAGAAGAGGG - Intronic
960470545 3:118059615-118059637 CAGAGAAGATATGAGGTAGAGGG - Intergenic
960995057 3:123335247-123335269 CAGGGCAGTCAGGAGGCCGAGGG - Intronic
961230612 3:125304152-125304174 GATACCAGACAGAAGGAAGAGGG + Intronic
961313175 3:126016684-126016706 CATGGCTGAGAGGAGGAAGAGGG + Intronic
961381739 3:126500042-126500064 GAGAGCAGGTAGGAGGAAGGAGG - Exonic
961430083 3:126875212-126875234 CAGAGCAGGAAGAGGGAAGAAGG + Intronic
961440707 3:126951554-126951576 AAGACCAGAGAGAAGGAAGAGGG + Intronic
961523786 3:127483824-127483846 AAGAGGAGGGAGGAGGAAGAGGG + Intergenic
961601672 3:128067045-128067067 CAGGGCAGACTGCAGGATGATGG - Exonic
961614309 3:128166778-128166800 GAGAGCAAGCAGGAGGGAGAAGG - Intronic
961831063 3:129623290-129623312 CTGTGAAGACAGGAGGGAGAAGG + Intergenic
962313419 3:134342092-134342114 CAGAGGAGACACAGGGAAGAAGG + Intergenic
962708232 3:138064871-138064893 CAGAAGGGCCAGGAGGAAGAAGG + Intronic
963067925 3:141278564-141278586 CACAGCAGTAAGGAGCAAGATGG + Intronic
964278209 3:155031448-155031470 CAGATCATAGAGGAAGAAGAAGG + Intronic
964423287 3:156527654-156527676 CTGAGAGGACAGGAGGAAAAGGG - Intronic
964919949 3:161884436-161884458 CACAGAAGACAGGAAGATGAGGG + Intergenic
965008492 3:163056438-163056460 GAGAGCAGAAAGGAGGAGAAGGG - Intergenic
965537720 3:169841268-169841290 CAGGGCTGCCAGGAGGAAGAAGG - Intronic
965620976 3:170642090-170642112 GACAGAAGACAGGGGGAAGAGGG - Intronic
965690053 3:171346148-171346170 CAGATGAAACAGCAGGAAGAAGG + Intronic
967200679 3:187070054-187070076 CATTTCAGCCAGGAGGAAGAAGG + Intronic
967621375 3:191638784-191638806 CTGTGAAGACAAGAGGAAGATGG + Intergenic
967666377 3:192177588-192177610 CAGAGCAGTAAGGAGGAAACAGG - Intronic
968009222 3:195262323-195262345 CAGGGGAGACAGGAGGACGGAGG + Intronic
968084830 3:195869587-195869609 CAGAGGACAAAGGAGGGAGACGG + Intronic
968294711 3:197567062-197567084 AAGAGAAAACAGGGGGAAGAAGG - Intronic
968531344 4:1093581-1093603 CAGAGCAGACAGGTGGCTGGAGG + Intronic
969056688 4:4406931-4406953 CAGAGCTGGCCGGAGAAAGAAGG - Intronic
969158688 4:5236019-5236041 CAGAGCAGCCAGGAGGGGGTGGG + Intronic
969282721 4:6181938-6181960 CTGTGCAGACAGGAGGAGGAGGG + Intronic
969307831 4:6335827-6335849 CAGAGCAGGCAGCAGGAGGAAGG + Intronic
969948062 4:10805227-10805249 CAGAACAGAAAGGTGGAGGAAGG + Intergenic
970424855 4:15936582-15936604 CTGAGCAGCCAGTAGGAGGAAGG + Exonic
970676936 4:18461926-18461948 CAGAGCAGAGAGAAGAAAAATGG + Intergenic
971013027 4:22459988-22460010 CAGAGCAGAAAGTAGAAAGAGGG - Intronic
971180275 4:24323767-24323789 CAGAGCAAAGAGCAGGAGGATGG - Intergenic
971349465 4:25843334-25843356 GAGTCCAGACAGGAGGATGACGG + Intronic
971664707 4:29467454-29467476 CAGGGCAGACAGGAGGAGCTGGG + Intergenic
971690328 4:29826441-29826463 CAGGTCAGACAGGAGGACTAAGG - Intergenic
972198051 4:36677939-36677961 CCTAGAAGACGGGAGGAAGATGG + Intergenic
972285496 4:37644064-37644086 CAGAGGAGAGAGGAGAAAAATGG + Intronic
972491086 4:39587749-39587771 CAAAGAAGAAAGGAGGAAGAAGG + Intronic
972627859 4:40818789-40818811 TAGAGCAGGAAGGAGGGAGAAGG - Intronic
972833714 4:42843321-42843343 CAGAGAGGACAGGAGGTGGAGGG - Intergenic
972968223 4:44539140-44539162 TGGAGCAGCAAGGAGGAAGAGGG + Intergenic
973559919 4:52124923-52124945 CAGAGCACAGAGCAGGGAGAAGG - Intergenic
973570204 4:52231111-52231133 CAGAAAAGAGAAGAGGAAGAAGG + Intergenic
973717732 4:53693802-53693824 AGAAGCAGACATGAGGAAGAGGG + Intronic
973783788 4:54316331-54316353 AAAAGCAGACAGAAGGAAAATGG - Intergenic
973815408 4:54614672-54614694 TAGAGCAGAGAGGAGCACGAGGG + Intergenic
973900784 4:55468766-55468788 TAAAGAAGACAGGAAGAAGAGGG + Intronic
974068741 4:57104878-57104900 GAGAGCAGACAGGCAGGAGAGGG + Intronic
974374172 4:61055360-61055382 CAGGGCAGAAATGAGCAAGAAGG + Intergenic
974524952 4:63038832-63038854 AAGAGCAGACAGGAGGGGAAGGG + Intergenic
974837726 4:67271172-67271194 CAGAGCAGAAATGAAGGAGATGG - Intergenic
975954535 4:79821896-79821918 CATAGCAAAGAGCAGGAAGAAGG + Intergenic
976093809 4:81486628-81486650 CAGAGCACACAGAAGGAGGGAGG + Intronic
977536775 4:98262334-98262356 CAGATTAGACAGGAGGAAGCTGG - Intronic
977736477 4:100422867-100422889 CAGAGCAGGCAGCAGTTAGATGG + Intronic
977775367 4:100913398-100913420 AAAAGCAGCCAGAAGGAAGAGGG - Intergenic
978006148 4:103619512-103619534 CAGAGCAGTCAGGCAAAAGAAGG - Intronic
978719092 4:111884964-111884986 AAGAGAAGAGAGAAGGAAGAAGG - Intergenic
980096241 4:128494013-128494035 CAGAAAAGAAAGAAGGAAGAGGG - Intergenic
980269681 4:130567912-130567934 AAGAGAAAATAGGAGGAAGAAGG + Intergenic
980575925 4:134683072-134683094 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
980993755 4:139761429-139761451 TGGAGCAGGGAGGAGGAAGAAGG - Intronic
981235678 4:142412669-142412691 CAGAGAATACAGAAGAAAGATGG - Intronic
981285199 4:143009566-143009588 CTCAGAAGACAGGAGGATGAGGG - Intergenic
981453083 4:144921324-144921346 CACAGAAGACAGGAAGATGAGGG - Intergenic
981831896 4:149011359-149011381 CAGAACAGACAGAAAGAAGAAGG + Intergenic
981861093 4:149357239-149357261 CAGAGCAGTCAGGCAGGAGAAGG - Intergenic
982112125 4:152066347-152066369 CAGAGGAGACAGCATGAACAAGG - Intergenic
982420040 4:155184005-155184027 AAGCGGAGACAGGAGGAAGAAGG - Intergenic
982948560 4:161659930-161659952 TAGAGCAGAAAGGATGCAGAGGG - Intronic
983930951 4:173452711-173452733 CAGAGCAGAAAGGATGAGTATGG + Intergenic
984598942 4:181704481-181704503 CAGTGAAGACAGGAGGGAGGAGG - Intergenic
985057936 4:186051311-186051333 CAGGGAAGACAGGAAGAGGAGGG - Intergenic
985314674 4:188643940-188643962 GAGGGGAGACAGGAGGAACATGG - Intergenic
985385581 4:189444193-189444215 CAAGGCAAACAGGATGAAGAAGG - Intergenic
985619245 5:945191-945213 CAGAGGAGGCAGGAGGAGCATGG - Intergenic
985988915 5:3539068-3539090 CAAGGAAGACAGGAAGAAGATGG + Intergenic
986002312 5:3639839-3639861 CAGAGAAGGCAGGGTGAAGAGGG - Intergenic
986420075 5:7571411-7571433 CAGAACAGAAAGGTGGAGGAAGG - Intronic
986519609 5:8600219-8600241 CAGAGCAGAAAAGAGGGTGAAGG - Intergenic
987397988 5:17443576-17443598 CAGGGGAGACAGAAGGGAGATGG - Intergenic
987793077 5:22593408-22593430 CAGGGAAAACAGGAGAAAGAAGG - Intronic
988399633 5:30746106-30746128 CAAAACAGAGAGGAGGCAGATGG - Intergenic
988474517 5:31572084-31572106 ATGAGCAAACAGGAAGAAGAGGG + Intergenic
988739740 5:34058610-34058632 CAGAGCAGACTGGAGCAAGGAGG + Intronic
989458275 5:41667207-41667229 TAGAGGAAACAAGAGGAAGAAGG + Intergenic
990642513 5:57803612-57803634 CATAGAAGAAAGGAGGAAAAGGG - Intergenic
991227827 5:64293023-64293045 CAGAGTAGACAGGGTGAGGAGGG - Intronic
991958039 5:72015144-72015166 CAGTGCAGGCAGGAACAAGAAGG + Intergenic
992258664 5:74948199-74948221 CACTGCAAACAGGAGGAAGCAGG + Intergenic
992992259 5:82296181-82296203 CATAGCAGACAGCAGCAAGCAGG + Intronic
994016738 5:94975429-94975451 CTGAGCACACAGCAGGAAGGTGG + Intronic
994285070 5:97955108-97955130 CTCAGAAGACAGGAGGATGAGGG + Intergenic
995443801 5:112220781-112220803 CAGGGGAAAAAGGAGGAAGAAGG - Intronic
995564883 5:113423927-113423949 CAGAGCTGAGTGGAGGAAAAGGG - Intronic
995572024 5:113490620-113490642 CTGAGAAGACAGGAAGAACAGGG + Intergenic
995629681 5:114119624-114119646 GTGATCAGACAGGAGGAAGACGG - Intergenic
995888582 5:116923422-116923444 CAGGGCAGACAGTGGGAAGGAGG + Intergenic
995892128 5:116966530-116966552 GAGAGTAGGCAGGAGAAAGATGG - Intergenic
995942691 5:117602987-117603009 AAGAGAAGAGAGGAGGAAGAAGG + Intergenic
996650314 5:125867928-125867950 CAGAAGAGACAGCAGGAAGCTGG + Intergenic
997208485 5:132064303-132064325 CAGACCAGCCTGGAGGCAGAAGG + Intergenic
997804624 5:136905001-136905023 GAAAGGAGAAAGGAGGAAGAAGG - Intergenic
997882921 5:137606301-137606323 CACTGCAGTCAGGAGGAGGATGG + Intergenic
998278484 5:140782042-140782064 CAGAAAAGACAGGAAGATGAGGG + Intergenic
998796565 5:145825998-145826020 CTGGGAAGACAGGAGGCAGATGG + Intronic
998971109 5:147593452-147593474 GAGAGCAGGGAGGAAGAAGAGGG - Intronic
999258185 5:150221559-150221581 CAGGGCAGAGAGGAGGAGGGAGG - Intronic
999452243 5:151687009-151687031 AGGAGGAGACAGGAGGAGGAGGG - Exonic
999640462 5:153667273-153667295 CACACCAGTCAGAAGGAAGAAGG - Intronic
999652636 5:153782758-153782780 GAGAACAGCCAGGCGGAAGACGG + Intronic
1001182012 5:169529299-169529321 CAGAGAGGGCAGGAGGTAGAAGG - Intergenic
1001241011 5:170069829-170069851 CAGAGTCCACAGGAAGAAGAGGG - Intronic
1001261141 5:170230045-170230067 ATGAACAGACAGGAGGAAAATGG + Intergenic
1001315096 5:170636345-170636367 CAGTGGAGGCAGGAGGCAGAAGG + Intronic
1001415017 5:171539610-171539632 CAAAGCAGACAGTAGAAGGAAGG - Intergenic
1001513109 5:172337371-172337393 CACACCAGCCAGGAGGAAGAGGG - Exonic
1001596026 5:172899247-172899269 TAGAGCAGGCAGGACGGAGAGGG + Intronic
1001683778 5:173577462-173577484 CACAGCAGGGAGGAGGAAGATGG + Intergenic
1001687281 5:173603266-173603288 CAGAGCAGTCAGGAAGATCAAGG - Intergenic
1001837587 5:174845038-174845060 CAGAGAAGGCAGGAGGCTGACGG - Intergenic
1001876477 5:175206157-175206179 CAGAGGAGAAAGGTGGAAAAGGG + Intergenic
1001952788 5:175827864-175827886 CAGGGCACGCAGGAGGCAGATGG - Intronic
1002299968 5:178252469-178252491 CAGAGCAGACAGGAAGAGGGAGG + Intronic
1002548130 5:179966001-179966023 CAGAGCAGCAACCAGGAAGATGG + Intronic
1002594595 5:180313723-180313745 CAGAGCAGGCCGGAGGAGGGCGG + Intronic
1002953344 6:1837883-1837905 GGGAGCAGACAGGAGGACTAGGG + Intronic
1003244171 6:4370183-4370205 CAGAGCAGGCAGAGGGGAGATGG + Intergenic
1003251081 6:4429703-4429725 CAGGTCAGTCAGGAGGCAGAGGG - Intergenic
1003332851 6:5144226-5144248 CACAGCCGCCAGGAGGAAGTCGG - Exonic
1003491943 6:6630438-6630460 CAGAGGAGACAGAAGGACCAAGG - Intronic
1003569567 6:7247130-7247152 CAAGGCAGACAAGAGGAAGAAGG + Exonic
1003798231 6:9630137-9630159 AGAAGCAGACAGGAAGAAGAGGG + Intronic
1003939056 6:11006041-11006063 CAGAGCAGTCAGAGGAAAGAAGG + Intronic
1004167196 6:13267138-13267160 CAGAGAAGACTGGAAGAGGATGG - Exonic
1004546555 6:16603715-16603737 CAGAACAGGCAGGAGGAAGTAGG + Intronic
1004548835 6:16626856-16626878 GAGAGGACACAGGGGGAAGATGG + Intronic
1004773515 6:18814981-18815003 AAGAGCAGGCAAAAGGAAGAAGG - Intergenic
1005083485 6:21980766-21980788 CAGAGCAGGAAGGAGGAGGCTGG - Intergenic
1005083491 6:21980792-21980814 CAGAGCAGGGAGGAGGAGGTGGG - Intergenic
1005083603 6:21981431-21981453 CAGAGCAGAAAAGAGGAGGCAGG - Intergenic
1005083646 6:21981668-21981690 CAGAGCAGGAAGGAGGAGGTAGG - Intergenic
1005083652 6:21981694-21981716 CAAAGCAGAAAGGAGGAGGTGGG - Intergenic
1005103915 6:22202992-22203014 CACAGAAGACAGGGAGAAGATGG + Intergenic
1005214983 6:23515324-23515346 CAGAGGAAACAGCAGTAAGAGGG - Intergenic
1006502707 6:34468538-34468560 CAGGGCAGCCAGGGGGCAGAGGG - Intronic
1006703663 6:35997894-35997916 CAGAGCACTCACCAGGAAGAAGG + Exonic
1006818591 6:36871914-36871936 CAGGGCAGACAGGAGTATTATGG + Intronic
1007068660 6:39018625-39018647 CAGATGACTCAGGAGGAAGATGG - Intronic
1007221823 6:40284687-40284709 CAGAGCAGAAAGGAGAAGGAAGG - Intergenic
1007236858 6:40396646-40396668 AAGAGCAGAAAGGCGGAAGGCGG + Intronic
1007322833 6:41039543-41039565 AATAGCAGATAGGAGGAGGAGGG + Intronic
1007749745 6:44064612-44064634 CAGAGAAGGCAGGAAGCAGAGGG + Intergenic
1007814601 6:44512443-44512465 CAGAAAAGACAGAATGAAGAAGG + Intergenic
1008502601 6:52198897-52198919 CTGAGAATACAGGGGGAAGAGGG + Intergenic
1008617543 6:53240967-53240989 AAGATCAGTCAGGAGGCAGAGGG + Intergenic
1009291799 6:61891898-61891920 CAGGGCAGTCAGGAAGGAGAAGG + Intronic
1009349148 6:62652786-62652808 CAGAGGAGACAGGAGAAAAGAGG - Intergenic
1009413799 6:63394952-63394974 CAGTGCACACAGAGGGAAGAAGG - Intergenic
1009426994 6:63525370-63525392 GAGAACAGACGGGAGGAAGGAGG + Intronic
1009901634 6:69813956-69813978 CAGAGCAGAGTGGAGAAGGATGG + Intergenic
1011517355 6:88167344-88167366 CCGTGCACACAGGAGGCAGACGG - Intergenic
1011720831 6:90154985-90155007 CACAGCAGACATGAGGAGAAGGG + Intronic
1012103299 6:95119981-95120003 CAGAGGAGACAGAAGGCATATGG - Intergenic
1012142091 6:95636765-95636787 CAGAGCAGACAAGAGGAGCAGGG + Intergenic
1012441964 6:99269172-99269194 CAGACCACACAGAAGGTAGAAGG - Intergenic
1012677778 6:102138553-102138575 CAAAGAAGACAGGAAGATGAGGG - Intergenic
1013029961 6:106323590-106323612 GAGAGCAGTCAGGTAGAAGAAGG - Intronic
1014040871 6:116823520-116823542 CAAAGAAGACAGGAAGATGAAGG - Intronic
1014051869 6:116964264-116964286 CAGAAAAGACATGAGGCAGAAGG - Intergenic
1014396996 6:120936237-120936259 GAGAGCACAAAAGAGGAAGAAGG + Intergenic
1014472623 6:121835100-121835122 CAGAGAAAACAGCAGGAACAAGG - Intergenic
1014813041 6:125906666-125906688 CTGGGGAGAGAGGAGGAAGAGGG + Intronic
1014831571 6:126108698-126108720 GAGAGAAGAGAGGAGGAAAATGG + Intergenic
1016295127 6:142565629-142565651 CAAAGCAGACAGGAGGAGTAAGG + Intergenic
1016479526 6:144467226-144467248 ATGAGCAGACAGGAGGAGGAGGG - Intronic
1016589409 6:145728320-145728342 CAGAGGAAGCAGGAGGATGAAGG + Intronic
1016650662 6:146455964-146455986 CAGAGCAAAGAGCAGGAGGACGG + Intergenic
1016874246 6:148849059-148849081 CAGAACAAAAAGGAGGAGGAAGG - Intronic
1016879978 6:148901483-148901505 CAGAGCAGAGAGGAACTAGAGGG + Intronic
1016989389 6:149918843-149918865 AAGAGGAGTCAGGAGGGAGAAGG + Intronic
1016997266 6:149969529-149969551 AAGAGGAGTCAGGGGGAAGAAGG - Intronic
1016998637 6:149979249-149979271 AAGAGGAGTCAGGAGGGAGAAGG - Intergenic
1017462958 6:154668365-154668387 AGGAGGAGAAAGGAGGAAGAAGG + Intergenic
1017590355 6:155972769-155972791 CATTCCAGACAGGAAGAAGAAGG + Intergenic
1017781469 6:157718865-157718887 GAGAAAAGAGAGGAGGAAGAAGG - Intronic
1018029747 6:159832466-159832488 GAAAGCAGAAAGGTGGAAGAAGG + Intergenic
1018246812 6:161831800-161831822 GAGAGGAGGCAGAAGGAAGAGGG + Intronic
1018574480 6:165245004-165245026 CAGAGCCAGCAGGAGGAATAAGG + Intergenic
1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG + Intronic
1019571956 7:1717028-1717050 CAGAGCATGCAGGAGGGAGGAGG + Intronic
1019767575 7:2863154-2863176 CAGAGAAGACTGCAGGAAGTGGG - Intergenic
1020070447 7:5223693-5223715 CCCAGCAGGCAGGAGGAATACGG - Intronic
1020628064 7:10607480-10607502 CAGAGGAGAGATGAGGCAGAAGG - Intergenic
1020762270 7:12283299-12283321 CAGAGGACACAGGAAGAAGTTGG - Intergenic
1021626545 7:22599082-22599104 CAGGCCAGACAGGAAGATGAGGG + Intronic
1021958230 7:25847762-25847784 CAGATAAGACAGGGAGAAGAAGG - Intergenic
1022232116 7:28424066-28424088 CAGAGAAGACAGAAGAAGGAGGG - Intronic
1022384299 7:29887469-29887491 CAGAGAAGGCTGGAGGAAGTAGG + Intronic
1022560344 7:31341937-31341959 AAGAGAAAACAGGAGGAAGGTGG - Intergenic
1022663795 7:32389935-32389957 GAGAGAAGACATGAGGATGAAGG - Intergenic
1023171561 7:37394604-37394626 CAGAGCAGAGAGGCTGATGAGGG + Intronic
1023382590 7:39623585-39623607 CAGAGCCGCCAGGAGGAGGGTGG + Exonic
1023728039 7:43164227-43164249 CAGAGAAGGCAGGAGGAGGAAGG + Intronic
1023774153 7:43587466-43587488 CAGAGCAGTCAGGGGTAATAGGG + Intronic
1024122421 7:46257986-46258008 CAAAGCAGAGAGGAGGAACCAGG - Intergenic
1024148217 7:46538764-46538786 CAATGCAGACAGGAAAAAGAGGG - Intergenic
1024242726 7:47447995-47448017 CAGAGAAGACAGCAGGAGGCTGG + Intronic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1024374123 7:48618567-48618589 CAGGTCAGCCAGGAGGCAGAGGG + Intronic
1024653718 7:51431413-51431435 CAGAGCAGCCAGGGAGAAGCTGG + Intergenic
1024681398 7:51693367-51693389 TAGAGCAGGCAGGTGGAAGAGGG + Intergenic
1025832814 7:65068764-65068786 CAGAGCTAAAAGGAGGAATATGG + Intergenic
1025902586 7:65758291-65758313 CAGAGCTAAAAGGAGGAATATGG + Intergenic
1026791504 7:73335503-73335525 TGGAGCAGACAGCAGGAAGGTGG - Intronic
1026877983 7:73890622-73890644 GAGAGGAGACGGGAGGAAGGAGG - Intergenic
1027266436 7:76497557-76497579 GGGAGCAGAGAGAAGGAAGAGGG - Intronic
1027317817 7:76995675-76995697 GGGAGCAGAGAGAAGGAAGAGGG - Intergenic
1027928448 7:84498813-84498835 CAGGGCAGAAAGTAAGAAGATGG - Intergenic
1028009701 7:85625794-85625816 GAGAGCAGAGAGTGGGAAGAAGG + Intergenic
1028146792 7:87328420-87328442 CAGAGGAGACAGGAGGGAAGAGG - Intergenic
1028150207 7:87363556-87363578 CAGAGTACACAGGAGGGAGCTGG + Intronic
1028163167 7:87508789-87508811 GAGAGCTGCAAGGAGGAAGAAGG + Intronic
1028738993 7:94250509-94250531 CAAAGCAGGCAGGAGGTAAAGGG + Intergenic
1030038659 7:105430573-105430595 CTGAGCACACAGTAAGAAGATGG + Intergenic
1030078849 7:105760007-105760029 TAGAGCAGGCAGGAGAATGAGGG - Intronic
1030401447 7:109056345-109056367 CAGTGCAGAAAGGATGAAGATGG - Intergenic
1030583093 7:111384289-111384311 GAGAGGAGAAAGGAGGAGGAGGG + Intronic
1030780893 7:113598454-113598476 CTGAGCAGAAAGTAGTAAGAAGG - Intergenic
1030944518 7:115700343-115700365 GAGAGGAGACAAGAGGAAGGCGG - Intergenic
1031174718 7:118336020-118336042 AAGAGCAGGCTGGAAGAAGAAGG - Intergenic
1031220749 7:118962188-118962210 CAGTGCAGGCAGGAGTATGAAGG + Intergenic
1031248478 7:119349386-119349408 CAGAACAGATAGGTGGAAGGTGG - Intergenic
1031484592 7:122311705-122311727 AAGAGGAGACAGTGGGAAGAGGG - Intergenic
1031618079 7:123904480-123904502 CAGAGAAGACAGGAACATGATGG - Intergenic
1031923508 7:127618174-127618196 CAGAGGAGAGAGGAGGAGGGAGG + Intergenic
1031937632 7:127751995-127752017 CAGAGCAGCAAGGAAAAAGATGG - Intronic
1032034807 7:128513905-128513927 GAGAGGAAAAAGGAGGAAGAAGG - Intergenic
1032246799 7:130220230-130220252 CAGGGCACACTGGAGGATGAGGG - Intergenic
1032394874 7:131582040-131582062 CAGAGGAGCCAGGAGGGAGGGGG - Intergenic
1033278802 7:139991454-139991476 CACAGCAGACAGCAGGCAGCAGG + Intronic
1033495214 7:141887233-141887255 CACTGCATACAAGAGGAAGAAGG - Intergenic
1033586910 7:142780807-142780829 AAGCGGAGACAGGAGGAGGATGG - Intergenic
1033641364 7:143265230-143265252 AAGAGAAGACAGCAGGAAGGCGG - Exonic
1034164413 7:149014487-149014509 GAGAGCAGAGCGGAAGAAGACGG - Intronic
1034439358 7:151078785-151078807 GAGGGCTGACAGGAGGAGGAAGG - Intronic
1034468510 7:151243682-151243704 CAGTGCCAAGAGGAGGAAGATGG - Exonic
1034983337 7:155491897-155491919 CAGAGCAGGAAGCAGGAAGGAGG + Intronic
1035117130 7:156533839-156533861 CAGTGAAGGCAGAAGGAAGAGGG + Intergenic
1035522282 8:284473-284495 CAGCCCAGACAGAAGGATGAGGG - Intergenic
1035582072 8:746800-746822 CAGAGCAGACAGAGGGAACCTGG - Intergenic
1035779082 8:2213198-2213220 TAGAGCAGAAACGAGGAGGAGGG + Intergenic
1035921391 8:3680185-3680207 CAGAGCAGAAATGAAGGAGATGG + Intronic
1036180098 8:6576984-6577006 CACAGCAGGCAGCAGGGAGAAGG - Intronic
1036242704 8:7092844-7092866 CAGAGTTGAGAGGAGGCAGATGG + Intergenic
1036639160 8:10571533-10571555 CAGAGCAAAGAGCAGGAGGACGG - Intergenic
1036692929 8:10956149-10956171 CAGTGCTGCCAGGAGGAAGTAGG + Intronic
1036899111 8:12658594-12658616 CAGAGTTGAGAGGAGGCAGATGG - Intergenic
1037237755 8:16740662-16740684 AAGAGCAGACAGGAGAGAGGAGG + Intergenic
1037410650 8:18592418-18592440 AAGAGCAGAAAGAAGAAAGAGGG + Intronic
1037744318 8:21630805-21630827 CAGAGCAGAATGCAGGGAGATGG + Intergenic
1037753875 8:21699260-21699282 AGGAGCAGACAGGAGGAGGGAGG + Intronic
1037948528 8:23004294-23004316 CGGAGCTGACAGGAGGAGGAAGG - Intronic
1037963734 8:23117772-23117794 CAGGGCAGCCATGAGGAAAAGGG - Intergenic
1038207338 8:25479240-25479262 CACAGCAGGGAGGAGGGAGAGGG - Intronic
1038338570 8:26664735-26664757 AAGGGAAGACAGGAGGAAGCTGG - Intergenic
1038524035 8:28257977-28257999 CAGAGCAGAGAAGAGGAAACTGG + Intergenic
1038547436 8:28436253-28436275 CTGAGCAGACAGGAGACAGCAGG - Intronic
1039308432 8:36289791-36289813 CAGACCAGACTAGAGGATGAAGG + Intergenic
1039743923 8:40406781-40406803 CAGAGCAGACAGGAGCCAGTTGG - Intergenic
1040520593 8:48172961-48172983 GAGGGTGGACAGGAGGAAGAGGG - Intergenic
1040614510 8:49020771-49020793 TACAGCATACAGGAGAAAGATGG + Intergenic
1041346804 8:56907445-56907467 CAGAGTTGGCAGGAGGGAGAGGG - Intergenic
1041822058 8:62047888-62047910 AAGAGAAGAAAGGAGAAAGAAGG - Intergenic
1042408862 8:68438901-68438923 AAGAGCAGAAGGAAGGAAGAAGG + Intronic
1042457085 8:69018417-69018439 CAATGTAGACAGGAAGAAGATGG - Intergenic
1042662916 8:71175540-71175562 GAGAGAAGACAGGAGGTAGAAGG - Intergenic
1043383020 8:79723102-79723124 CCCAGCAGACAGGAGGCAGGGGG + Intergenic
1044051353 8:87509710-87509732 TAGAACAGAAAGGTGGAAGAAGG + Intronic
1044183722 8:89226497-89226519 GAGAGAAGACAGGAGGTATATGG - Intergenic
1044372327 8:91426684-91426706 CAGAAGAGGGAGGAGGAAGAGGG - Intergenic
1044622725 8:94206263-94206285 AAGAACAGACAGGAAGAAGAAGG - Intronic
1044785790 8:95791147-95791169 CAGTGCTGATAGGAGGAAGTTGG + Intergenic
1045176969 8:99735946-99735968 CAGAGAACACAAGAGGGAGATGG - Intronic
1045511402 8:102814588-102814610 TGGAGGAGCCAGGAGGAAGAAGG - Intergenic
1045748364 8:105451796-105451818 CACAGCAGCCAGGAGTTAGAAGG + Intronic
1046935765 8:119883921-119883943 CAGAGCAGGCAGGATTCAGAAGG + Intronic
1047228888 8:122979334-122979356 AAGGGCAGCCAGGAGGAAGTCGG + Intergenic
1047977925 8:130149939-130149961 CAGAGCAGCCTGGAGGGAAATGG - Intronic
1048176081 8:132154011-132154033 AAGAGAGGACAGGAGGAAAAAGG - Intronic
1048512826 8:135078079-135078101 GAGGGCAGAGAGAAGGAAGAGGG - Intergenic
1048940449 8:139396077-139396099 CAGGGCAGACAGAGAGAAGACGG - Intergenic
1049086112 8:140479887-140479909 CAGAGCAGTCAGGAAAAAGTGGG + Intergenic
1049215626 8:141406536-141406558 CAGAGCAGAGTGGAAGAAGTGGG - Intronic
1049329503 8:142042785-142042807 CAGAGAAAACGGGAGGAAGCGGG + Intergenic
1049415156 8:142491694-142491716 CAGAGCAGCCAGGAGGGACTGGG - Intronic
1049478319 8:142807118-142807140 GAGGGCAGACAGGATGAGGAGGG - Intergenic
1049488773 8:142880009-142880031 CAGGGCTGAGAGGAGCAAGATGG + Intronic
1049589620 8:143451177-143451199 CAGAGCAGAAGGCAGGAAGCAGG + Intronic
1049800339 8:144514698-144514720 CAGAGCAGACAGACTGAAGTAGG + Intronic
1049822124 8:144641831-144641853 CAGTGCAGCCACGAGGAGGAGGG + Intergenic
1050181904 9:2932457-2932479 CAGAGTAGAAAGGAGCAAAAAGG + Intergenic
1050432806 9:5578994-5579016 CAGAGCAGAGGAGAGGAGGATGG + Intergenic
1050518238 9:6468567-6468589 CAGAGCAGCTAGGAGTAGGATGG + Intronic
1050926425 9:11269139-11269161 CAGAGGAGACCAGAGGAAAAAGG - Intergenic
1051136438 9:13927029-13927051 GAGAGGAGACAGGAGGAGGAGGG - Intergenic
1051278354 9:15418083-15418105 GGGAGGAGACAGAAGGAAGAAGG - Intergenic
1051849596 9:21490973-21490995 CAGAGCAAAGAGCAGGAGGATGG + Intergenic
1052706653 9:32001389-32001411 GAGAGGAGACAAGTGGAAGAGGG + Intergenic
1052857905 9:33418399-33418421 CAGAGAGTACAGCAGGAAGAGGG + Intergenic
1053361895 9:37493972-37493994 CAGGGCACAGAGGAGGGAGAAGG + Intronic
1053518115 9:38749195-38749217 CAGAGCACACAGGGAGAACATGG - Intergenic
1055003546 9:71480941-71480963 CAAAGCAAACAGGAAGGAGAAGG - Intergenic
1055888680 9:81098471-81098493 CAGACCAGACAAAAGGAAGAGGG + Intergenic
1055928598 9:81536474-81536496 GAGGGCATAGAGGAGGAAGAGGG + Intergenic
1056121398 9:83492532-83492554 CAGGGCAGGCAGGAGGAACGGGG + Intronic
1056236095 9:84596201-84596223 GAGAGGAGAGAGGAGGAAGATGG - Intergenic
1056251677 9:84754804-84754826 CAGATGGGACAGGAGGAAGGTGG + Intronic
1056703333 9:88930246-88930268 CAAATCAGTCAGGAGAAAGAAGG + Intergenic
1057206056 9:93173315-93173337 CAGAGCAGAAAGAAGGAACCGGG - Intergenic
1057633985 9:96746082-96746104 CAGAGAAGACAGTGTGAAGACGG + Intergenic
1057802134 9:98197085-98197107 GAGGGGAGAAAGGAGGAAGAAGG + Intergenic
1059550294 9:115222311-115222333 GACGGCAGACAGGAGGGAGAGGG + Intronic
1059588973 9:115637012-115637034 TAGAGCTTACAGAAGGAAGAGGG - Intergenic
1059984139 9:119805545-119805567 TAGAGCAGACATAGGGAAGAAGG + Intergenic
1060016202 9:120088430-120088452 CAGAGCAGTAGGGAGGAAGATGG + Intergenic
1060055916 9:120412898-120412920 CAGGGGAGAGTGGAGGAAGATGG - Intronic
1060349186 9:122842731-122842753 GAGATCAGGAAGGAGGAAGAGGG - Intergenic
1060992687 9:127857803-127857825 CAGAGGAGGCAGGAGGAGGAGGG + Intergenic
1061018269 9:127995822-127995844 CAGCTCAGACAGTAGTAAGAGGG + Intergenic
1061386914 9:130295825-130295847 CAGGGCAAGTAGGAGGAAGATGG - Intronic
1061846131 9:133389436-133389458 CAGAGCAGCCAGCAGGATGGTGG - Intronic
1061971478 9:134047677-134047699 CACAGCAGACAGGAGTGAGGCGG - Intronic
1062038599 9:134393787-134393809 AAGCACACACAGGAGGAAGAGGG - Intronic
1062137547 9:134937733-134937755 CAGAGCTGACTGGAGGAGGCAGG - Intergenic
1062725583 9:138071595-138071617 GAGAGAAGCCAGGAGGAAGGGGG + Intronic
1203747685 Un_GL000218v1:52475-52497 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1203631183 Un_KI270750v1:73855-73877 CAGAGCAGACAGAAGGCAGGAGG - Intergenic
1185676954 X:1856970-1856992 GAGAGAAGACAGGAGGGAGAAGG - Intergenic
1185688279 X:1948314-1948336 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185688580 X:2133890-2133912 GAGGGGAGACAGGAGGAGGAGGG + Intergenic
1185827034 X:3261346-3261368 CAGACCAGGAAGGAGGAAGGAGG + Intergenic
1186053695 X:5626847-5626869 AAGAGCAGACAGAGGGAGGAAGG + Intergenic
1186165814 X:6824908-6824930 AAGAGCACCCAGGTGGAAGACGG + Intergenic
1186404858 X:9292992-9293014 CAGAGCAGACAGGTGACTGAGGG - Intergenic
1186540281 X:10393304-10393326 GAGAGGAGAAAGGTGGAAGATGG - Intergenic
1186577770 X:10784973-10784995 CAGGGCAGTCAGGCAGAAGAGGG + Intronic
1186901604 X:14063359-14063381 CATAGCAGGAAGGATGAAGAAGG - Intergenic
1187182537 X:16956602-16956624 CAGGACAGACTGGAGGAGGAGGG - Intronic
1187743734 X:22385371-22385393 GAGAGCAGAGTGGAGGAAAAAGG - Intergenic
1188393358 X:29648783-29648805 CAGAGCAGAAAAGAGTAAAATGG + Intronic
1188444253 X:30240071-30240093 GAGATCAGATAGGAGGAAGAGGG - Intergenic
1188983195 X:36746821-36746843 CAGAAGAGACAGGAAGAAGAGGG - Intergenic
1189261360 X:39681051-39681073 CAGAGCATGGAGGGGGAAGAAGG - Intergenic
1189447810 X:41097030-41097052 CAGACCACACAGGAGAAACAAGG - Intronic
1189510733 X:41658673-41658695 AGGAGCAGCCAGGAGGTAGAAGG + Intronic
1189739039 X:44100009-44100031 CAGAGCAAACAGGAAGCACAAGG + Intergenic
1190051332 X:47151726-47151748 CAGTTGAGACAGTAGGAAGAAGG + Intronic
1190141423 X:47848884-47848906 CTGAGCAGACAGGAGAAAGATGG - Intronic
1190568233 X:51753018-51753040 CAGAGAAGACAGGACACAGAGGG - Intergenic
1190707561 X:53043419-53043441 GAGAGAAGACAGGGGGAACAAGG - Intergenic
1190909703 X:54759348-54759370 CAGAGTTGACAGGAGGCAGTGGG + Intronic
1191006218 X:55714100-55714122 AAGAGGAAAAAGGAGGAAGAGGG - Intergenic
1191113721 X:56830360-56830382 CAGAGCAGAACTGAGGGAGATGG - Intergenic
1191585646 X:62823730-62823752 CAGGGAAGTCAGGAAGAAGAAGG + Intergenic
1191612674 X:63133818-63133840 AAGAAAAAACAGGAGGAAGAAGG + Intergenic
1191623623 X:63245108-63245130 AAGAAAAAACAGGAGGAAGAAGG - Intergenic
1191738831 X:64416386-64416408 CAGAGCATTCAGAAGGAACATGG - Intergenic
1191764488 X:64682365-64682387 CAGGGGACACAGGAGGAAGGGGG + Intergenic
1192012119 X:67285684-67285706 CAGAGGAGACAAAAGGAAAAGGG - Intergenic
1192168876 X:68842412-68842434 CAGAGGTGACAGGATGAACAGGG - Intergenic
1192169014 X:68843057-68843079 CAGAGGAAAGAGGAAGAAGAAGG + Intergenic
1192498455 X:71632466-71632488 AAGAGCAGACACCCGGAAGAAGG - Intergenic
1192542747 X:71989089-71989111 CAGAGCTGAGGGGAAGAAGAAGG - Intergenic
1192942101 X:75923282-75923304 CAGGGCAATCAGGAAGAAGAAGG + Intergenic
1193074109 X:77337102-77337124 CAGAGCAGAACTGAGGGAGATGG + Intergenic
1193081716 X:77412665-77412687 AAGAGCAGTCAGGAAGTAGAAGG + Intergenic
1193260336 X:79399002-79399024 CAGAGCACAGAGGAGGGAAAGGG - Intergenic
1193367018 X:80646816-80646838 TAGAGAACACAGGAGAAAGAAGG - Intergenic
1193535303 X:82708040-82708062 CAGAGGAGAAAGCTGGAAGATGG + Intergenic
1195007873 X:100704482-100704504 CTGAGCAGAGAGGATGAAGAAGG + Intronic
1195699036 X:107688565-107688587 CAGAGCAGGCAGGAACCAGAAGG + Intergenic
1196006540 X:110843316-110843338 CAGAGGAAACAGTAGGAAGTGGG - Intergenic
1196130189 X:112147293-112147315 CAGGGCAGAGAAGGGGAAGAGGG - Intergenic
1196281627 X:113829401-113829423 AAGAGGAGTCTGGAGGAAGAAGG - Intergenic
1197265613 X:124367136-124367158 CAGATCAGACAACAGGATGAGGG - Intronic
1197711872 X:129677574-129677596 CTAAGGAAACAGGAGGAAGAAGG + Intergenic
1198085930 X:133282102-133282124 CAGAGCAGAAATGAAGGAGATGG + Intergenic
1198406249 X:136315538-136315560 CAGAGCAGATTTGAGGAAAAGGG - Intronic
1199373306 X:147077123-147077145 CAGAGCATAAAAGTGGAAGAAGG + Intergenic
1199709593 X:150459792-150459814 AAGAGAAGAAAGGAGAAAGATGG + Intronic
1200239709 X:154487055-154487077 CAGACCAGAAAGGAGGAGGTAGG - Intergenic
1201161017 Y:11167460-11167482 CAGGTCAGACAGGTGGAGGAGGG + Intergenic
1201321100 Y:12699363-12699385 AAGAGGAGAGAGGAGGAAAAAGG + Intergenic
1201589037 Y:15593486-15593508 AGGAGAAGAGAGGAGGAAGAGGG - Intergenic
1201918147 Y:19204769-19204791 CATGGCAGGCAGGAGAAAGAAGG + Intergenic