ID: 1150438733

View in Genome Browser
Species Human (GRCh38)
Location 17:65174279-65174301
Sequence CTGCCTCGGTGACTTCGGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 73}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150438733_1150438739 16 Left 1150438733 17:65174279-65174301 CCACACCGAAGTCACCGAGGCAG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1150438739 17:65174318-65174340 AGCAGCCAGACACTGGTTGTAGG 0: 1
1: 0
2: 1
3: 12
4: 152
1150438733_1150438738 9 Left 1150438733 17:65174279-65174301 CCACACCGAAGTCACCGAGGCAG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1150438738 17:65174311-65174333 GTGGAATAGCAGCCAGACACTGG 0: 1
1: 0
2: 1
3: 14
4: 176
1150438733_1150438735 -10 Left 1150438733 17:65174279-65174301 CCACACCGAAGTCACCGAGGCAG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1150438735 17:65174292-65174314 ACCGAGGCAGTGAGCGCCTGTGG 0: 1
1: 0
2: 0
3: 7
4: 169
1150438733_1150438740 17 Left 1150438733 17:65174279-65174301 CCACACCGAAGTCACCGAGGCAG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1150438740 17:65174319-65174341 GCAGCCAGACACTGGTTGTAGGG 0: 1
1: 0
2: 0
3: 8
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150438733 Original CRISPR CTGCCTCGGTGACTTCGGTG TGG (reversed) Intronic
902286362 1:15410669-15410691 CAGCCTCGGTGTGTGCGGTGTGG - Intronic
918527855 1:185484770-185484792 CAGCCTGGGAGACTTCGTTGTGG - Intergenic
919478298 1:198055870-198055892 TTTCCTCAGTGACTTAGGTGTGG + Intergenic
920034072 1:203054402-203054424 CTGGCTCTGTCACTTCTGTGTGG - Intronic
1063678358 10:8162108-8162130 CTGTGTCTGTGACTACGGTGAGG - Intergenic
1065300721 10:24318909-24318931 GTGCCTCTGTGAGTTCGCTGTGG + Intronic
1067030276 10:42875128-42875150 CAGCCTGGATGCCTTCGGTGAGG - Intergenic
1067407444 10:46036108-46036130 CTGGCTCCCTGACTTGGGTGAGG - Intronic
1069746117 10:70716103-70716125 CTGCCTTGGTGACTGCTGTTTGG + Intronic
1073326289 10:102645516-102645538 CTGCCTCGGTGACTTCCCGTAGG - Intronic
1078623683 11:12933794-12933816 CTGGCTCTGTGACCTCGGGGTGG - Intronic
1083992865 11:66257712-66257734 CTACCTCGGTGGCGTCGGAGGGG - Intronic
1093497235 12:19772151-19772173 CTGCCTCGGCTACTTCAGTCAGG + Intergenic
1096545938 12:52340340-52340362 CTGCCTCTGTTTCTTCAGTGAGG + Intergenic
1097889027 12:64759156-64759178 CTGCCTGGGGGTCTTCGGGGTGG - Exonic
1102399692 12:112617658-112617680 CTGCCTCGGAGACTTCCTGGAGG + Intronic
1113487601 13:110665727-110665749 CTTCCTCGTTGACTTCGTTCAGG - Intronic
1118808339 14:69256674-69256696 CTGCCTCTGGGCCTTTGGTGTGG - Intergenic
1122687068 14:103514107-103514129 CTGCTGCTGTGACTTGGGTGGGG + Intergenic
1125608059 15:40953384-40953406 CTGCCGCGGTGATTGGGGTGGGG - Exonic
1127397310 15:58552939-58552961 CTGCCCCGGTCAGTTCAGTGTGG + Intronic
1135826230 16:25731023-25731045 CTGCCTAGGTGAGTTGGCTGGGG - Intronic
1142107931 16:88316161-88316183 CTGCCCCGGAGATTCCGGTGAGG - Intergenic
1144437799 17:15257073-15257095 CTGCCTCGTTGCTTTCCGTGAGG - Intronic
1148818646 17:50347477-50347499 CTGGCTCCGTGACATCCGTGGGG + Intronic
1150438733 17:65174279-65174301 CTGCCTCGGTGACTTCGGTGTGG - Intronic
1152779022 17:82218288-82218310 CAGCCTCGGTCACTGCGGGGTGG + Intergenic
1152779067 17:82218407-82218429 CAGCCTCGGTCACTGCGGGGTGG + Intergenic
1152779080 17:82218446-82218468 CAGCCTCGGTCACTGCGGGGTGG + Intergenic
1152780986 17:82227366-82227388 GTGTCTCGGTGGCTTCAGTGGGG + Intergenic
1164630672 19:29759664-29759686 CTGCTCCCGGGACTTCGGTGGGG + Intergenic
1165708335 19:37991969-37991991 CTGCCTCGTTGACTTTGGGCTGG + Intronic
926885969 2:17599112-17599134 CTGCCTAGGTGACTATGGTCTGG + Intronic
928195702 2:29215225-29215247 CTGGCTGGGTGACTTCCCTGTGG - Intronic
928284104 2:29974054-29974076 CTGCCTCTGTGCCTTGGGTCAGG + Intergenic
937984052 2:127630678-127630700 CAGCCTCAGTGACTTGGGAGGGG - Intronic
938376505 2:130810602-130810624 CTGCCTCGGGGGCTCCCGTGTGG - Intergenic
941580862 2:167293847-167293869 TTGCCCCGGGGACTTCGGAGGGG + Intergenic
946889573 2:224261191-224261213 CTGCCTCCGTGGCTTCCGTTAGG - Intergenic
1171090278 20:22278809-22278831 CTGCCTGGTTGAATTCTGTGAGG - Intergenic
1173827827 20:46058592-46058614 CCGCCCCGGTGCCTTCGCTGGGG + Intronic
1176062878 20:63179910-63179932 CTGCCTGGCTGACTGGGGTGGGG - Intergenic
1177805688 21:25872514-25872536 CTGCCTCTGTGAGTGCTGTGTGG + Intergenic
1179377443 21:40863273-40863295 CTGCCTTGGTGGCTTCAATGGGG - Intergenic
1181465632 22:23109272-23109294 CTGGCTCCGTGGCTTTGGTGGGG - Intronic
1183950539 22:41350175-41350197 CTGCCTCAGAGACTTCAGTCTGG - Intronic
1184156278 22:42669590-42669612 CTGCCTGGGAGACTGCGGGGTGG + Intergenic
1185111270 22:48901493-48901515 CTGCCCCGGTGCCTTGGGTTGGG + Intergenic
1185135397 22:49068742-49068764 CTGCCTCTGTGAATTCCCTGCGG + Intergenic
955345733 3:58160561-58160583 CTGCCTCGGTGAGTTCAGGAGGG + Intronic
961483174 3:127196969-127196991 CTGCCTTGGTGCCTTCAGTGTGG + Exonic
961486618 3:127221622-127221644 CTGCTTTGGTGCCTTCGGTGTGG - Intergenic
968579741 4:1384309-1384331 CTGCAGCGGTGACTTCAGGGAGG + Intronic
973634104 4:52846105-52846127 CCACCTCGGTGACTGTGGTGAGG - Intergenic
985282654 4:188302363-188302385 CTGTCTCAGTGACCTCAGTGGGG + Intergenic
985712078 5:1435219-1435241 CTGCCTGGGTGAGTTCACTGTGG - Intronic
992068662 5:73129912-73129934 CTGCCTCGCTGCATTCTGTGTGG - Intronic
999573972 5:152953301-152953323 CTGCCTAGGGGACTTCGGGTAGG + Intergenic
1000230660 5:159312287-159312309 CTGCTTCGCTGACCTCTGTGAGG - Intergenic
1004324437 6:14661893-14661915 CTGCCTCAGCGACTTCGGAGTGG - Intergenic
1019627019 7:2021351-2021373 CTGCCTGAGTGGCTTCGGTCAGG - Intronic
1024626384 7:51211335-51211357 CTGCCTCTCTGACCTGGGTGGGG + Intronic
1030524328 7:110635322-110635344 CTGGCTCAGTGGCTTCCGTGTGG - Intergenic
1035656595 8:1312297-1312319 TTTCCTAGGTGCCTTCGGTGCGG - Intergenic
1036798864 8:11774915-11774937 CTGCCTCTGTGGCTTTGGTAGGG + Intronic
1037882421 8:22579556-22579578 CGGCCTCGGGGACTGGGGTGGGG + Intronic
1037962062 8:23105192-23105214 CTGGCTCTGTGACTCTGGTGTGG + Intronic
1038424046 8:27453129-27453151 CAGCCTCGGGGGCTTCTGTGGGG - Exonic
1038784310 8:30597122-30597144 CTTCCTTGGTGACTGGGGTGTGG + Intronic
1043847577 8:85179403-85179425 CTGCCTCTGTGACTTCTGTAGGG - Intronic
1052955358 9:34249715-34249737 CTGCCTCAGTGACTTCTTTGGGG + Intronic
1059715260 9:116907394-116907416 CTGCCTCGGACACTTCCCTGAGG - Intronic
1060658321 9:125388022-125388044 CTGCCTCTGTGAGTTCTTTGGGG + Intergenic
1061308008 9:129743534-129743556 CTGCATAGGTGACAGCGGTGAGG + Intronic
1062292600 9:135803646-135803668 CTTACGCGGTGACTCCGGTGTGG + Intergenic
1062607191 9:137353593-137353615 CTGCCACGGTGGCTGCGGGGTGG - Intronic
1186192224 X:7077010-7077032 CTGGCCTGGTGACTTAGGTGCGG + Intronic
1191942819 X:66499057-66499079 CCACATCGGTGACTTCTGTGGGG - Intergenic
1200250514 X:154551390-154551412 CTGCCTCGGAGACTGGAGTGAGG - Intronic