ID: 1150439149

View in Genome Browser
Species Human (GRCh38)
Location 17:65177408-65177430
Sequence CATGCATCCCACTATGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 65}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150439138_1150439149 21 Left 1150439138 17:65177364-65177386 CCATCTACCCGCCACCCATTTAC 0: 1
1: 0
2: 0
3: 23
4: 219
Right 1150439149 17:65177408-65177430 CATGCATCCCACTATGGTGCTGG 0: 1
1: 0
2: 2
3: 4
4: 65
1150439142_1150439149 7 Left 1150439142 17:65177378-65177400 CCCATTTACCTATTCATCCATCC 0: 1
1: 7
2: 60
3: 418
4: 1916
Right 1150439149 17:65177408-65177430 CATGCATCCCACTATGGTGCTGG 0: 1
1: 0
2: 2
3: 4
4: 65
1150439144_1150439149 -1 Left 1150439144 17:65177386-65177408 CCTATTCATCCATCCACTTATCC 0: 2
1: 24
2: 156
3: 865
4: 3531
Right 1150439149 17:65177408-65177430 CATGCATCCCACTATGGTGCTGG 0: 1
1: 0
2: 2
3: 4
4: 65
1150439143_1150439149 6 Left 1150439143 17:65177379-65177401 CCATTTACCTATTCATCCATCCA 0: 1
1: 16
2: 165
3: 1393
4: 6197
Right 1150439149 17:65177408-65177430 CATGCATCCCACTATGGTGCTGG 0: 1
1: 0
2: 2
3: 4
4: 65
1150439137_1150439149 28 Left 1150439137 17:65177357-65177379 CCATCAACCATCTACCCGCCACC 0: 1
1: 0
2: 2
3: 24
4: 285
Right 1150439149 17:65177408-65177430 CATGCATCCCACTATGGTGCTGG 0: 1
1: 0
2: 2
3: 4
4: 65
1150439136_1150439149 29 Left 1150439136 17:65177356-65177378 CCCATCAACCATCTACCCGCCAC 0: 1
1: 0
2: 0
3: 13
4: 112
Right 1150439149 17:65177408-65177430 CATGCATCCCACTATGGTGCTGG 0: 1
1: 0
2: 2
3: 4
4: 65
1150439140_1150439149 13 Left 1150439140 17:65177372-65177394 CCGCCACCCATTTACCTATTCAT 0: 1
1: 1
2: 8
3: 50
4: 404
Right 1150439149 17:65177408-65177430 CATGCATCCCACTATGGTGCTGG 0: 1
1: 0
2: 2
3: 4
4: 65
1150439139_1150439149 14 Left 1150439139 17:65177371-65177393 CCCGCCACCCATTTACCTATTCA 0: 1
1: 2
2: 10
3: 136
4: 987
Right 1150439149 17:65177408-65177430 CATGCATCCCACTATGGTGCTGG 0: 1
1: 0
2: 2
3: 4
4: 65
1150439141_1150439149 10 Left 1150439141 17:65177375-65177397 CCACCCATTTACCTATTCATCCA 0: 1
1: 7
2: 72
3: 549
4: 2972
Right 1150439149 17:65177408-65177430 CATGCATCCCACTATGGTGCTGG 0: 1
1: 0
2: 2
3: 4
4: 65
1150439145_1150439149 -10 Left 1150439145 17:65177395-65177417 CCATCCACTTATCCATGCATCCC 0: 1
1: 2
2: 41
3: 716
4: 3901
Right 1150439149 17:65177408-65177430 CATGCATCCCACTATGGTGCTGG 0: 1
1: 0
2: 2
3: 4
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150439149 Original CRISPR CATGCATCCCACTATGGTGC TGG Intronic
916368152 1:164057384-164057406 CATGCATCACACTGTTCTGCAGG - Intergenic
917636489 1:176942163-176942185 CATAGATCCCACTATGGGTCAGG + Intronic
918823692 1:189294002-189294024 TATGCATCACATTTTGGTGCAGG + Intergenic
920567145 1:206983305-206983327 CATGCATCTCAGTGGGGTGCCGG + Intergenic
921898962 1:220430275-220430297 CAGGCATTCCACTATGAGGCAGG + Intergenic
1065822474 10:29538641-29538663 CATGCAGCACACTATGGAGATGG - Intronic
1065855093 10:29823587-29823609 CATGCATCCCTATGTGGCGCCGG - Intergenic
1067546621 10:47196677-47196699 CATGCAGCCCTCTGTGATGCAGG + Intergenic
1070667547 10:78356157-78356179 CATTCAACCCACTATGGAGTGGG + Intergenic
1070742670 10:78913090-78913112 CAGGCATCCCCAAATGGTGCTGG + Intergenic
1073431877 10:103492444-103492466 CATGCTTCCCACTGTGGGCCAGG - Intergenic
1074987524 10:118670930-118670952 CATGCAGCTCACTTTGGAGCTGG + Intergenic
1075453212 10:122567752-122567774 CCTGCTTCCCACCATGGAGCTGG - Intronic
1077418577 11:2437439-2437461 CCTGAATCCCACAGTGGTGCAGG - Intergenic
1078331931 11:10429523-10429545 CCTGCTTCCCAGAATGGTGCTGG + Intronic
1078869605 11:15331067-15331089 CAGGCATCACAGTATGGTGCTGG - Intergenic
1084807919 11:71591798-71591820 CATGACTCCCATTATGGTGGGGG - Intronic
1103106887 12:118235491-118235513 CATGAACTCAACTATGGTGCTGG - Intronic
1103828795 12:123762507-123762529 CATCTACCGCACTATGGTGCCGG + Exonic
1110008130 13:70297467-70297489 CCTGGAGCCCACAATGGTGCAGG - Intergenic
1110405155 13:75142889-75142911 CATGCTTCCCACTGTGGAACTGG + Intergenic
1111480700 13:88822019-88822041 CAAGCATACCACTCTGGTGGGGG + Intergenic
1111533076 13:89565540-89565562 CAAGCATGCCACTTTGGTGCAGG + Intergenic
1111939186 13:94591334-94591356 CTTGCACCTCACTTTGGTGCAGG - Intronic
1116436528 14:44900602-44900624 CAAGAATCCATCTATGGTGCAGG - Exonic
1117695611 14:58359394-58359416 CAAACATCCCACTCTGGTGGGGG - Intronic
1122060891 14:99136098-99136120 CTGGCAGCCCACTGTGGTGCAGG + Intergenic
1127013608 15:54657842-54657864 CAAGCATTCCACAAAGGTGCTGG + Intergenic
1128466657 15:67918356-67918378 CATGGATCCCACTCCTGTGCCGG - Intergenic
1137421449 16:48338278-48338300 CATGGATCCCACTTTAATGCAGG + Intronic
1143852592 17:9823887-9823909 CATGTATCCCACTTGGCTGCAGG + Intronic
1146708120 17:35017018-35017040 CATGAAACCCAGCATGGTGCTGG + Intronic
1150439059 17:65177013-65177035 CATCCATCTCACTATGGTGCTGG + Intronic
1150439079 17:65177110-65177132 CATCCATCTCACTATGGTGCTGG + Intronic
1150439121 17:65177281-65177303 CACCCATCCAACTCTGGTGCTGG + Intronic
1150439149 17:65177408-65177430 CATGCATCCCACTATGGTGCTGG + Intronic
1152383955 17:79957733-79957755 CATGTGTCCCACTCTGGTGGGGG + Intronic
1156549110 18:37996365-37996387 GATGCATCCCACTCTGCTGTAGG - Intergenic
1159535859 18:69713953-69713975 GATGTGTCCCACTATGGTGGAGG + Intronic
929857444 2:45649296-45649318 CACTCATCTCACTTTGGTGCTGG + Intergenic
933415050 2:81976998-81977020 CATGCATCCCTCATTAGTGCAGG - Intergenic
937748969 2:125451344-125451366 CATGCCTCCAACAATGATGCAGG + Intergenic
947550441 2:231041667-231041689 CATGCACCCCACCATGCTCCTGG - Intronic
1173465239 20:43275688-43275710 CATGCATCCCACCATGGTTATGG + Intergenic
1178381770 21:32115745-32115767 CCTGCATGCCACTGTGGTGATGG - Intergenic
1178665782 21:34545068-34545090 CATGCCTGCCATCATGGTGCGGG + Intronic
1182013135 22:27017089-27017111 CAAGCTTCCCACTATCTTGCTGG - Intergenic
949939414 3:9143323-9143345 TAGGCAACCCACTTTGGTGCTGG - Intronic
950745592 3:15085602-15085624 TATGAATCCCACTCAGGTGCTGG - Intronic
950959246 3:17087691-17087713 CAAGTATACCACTGTGGTGCGGG + Intronic
952422992 3:33148122-33148144 CATGCATGCCACTAAAGGGCAGG + Intergenic
957183094 3:76907091-76907113 CATGTATTCAACTATGATGCAGG - Intronic
963457547 3:145564595-145564617 CATGTCTCCCACTAAGTTGCTGG + Intergenic
964627872 3:158776614-158776636 CATGCATCCCAGTACCCTGCAGG + Intronic
967804210 3:193700347-193700369 CATGGATCCCAAAATGCTGCTGG - Intergenic
968137943 3:196232542-196232564 CATCCATCCCACGATGGGACAGG - Intronic
968273395 3:197422212-197422234 CATACACCCCACAATGGAGCAGG - Intergenic
983935314 4:173498921-173498943 CATGCATGCCACTAGAATGCTGG + Intergenic
985419314 4:189767821-189767843 AATGCATCCTACTATTGTGGAGG - Intergenic
986066023 5:4234961-4234983 CATGCATCCCTGGATGATGCAGG + Intergenic
1001880847 5:175242838-175242860 TATGCATCCCGCTATGTGGCAGG - Intergenic
1003032061 6:2610174-2610196 CATGTATGCCACTCTGGTGAGGG - Intergenic
1006620608 6:35361309-35361331 CTGGCATCCACCTATGGTGCTGG - Intronic
1016096617 6:140045340-140045362 CATGCTTCCAACTAGGGTGAGGG + Intergenic
1023806947 7:43879054-43879076 CAGGAATACCACTATGGTGCTGG - Exonic
1028960668 7:96746378-96746400 CATGCATACAACTATGTTTCGGG + Intergenic
1040542402 8:48372168-48372190 CCTGCACCCCTCTATGGTACTGG + Intergenic
1041356051 8:57001486-57001508 TCTGCACCCCACTATGGAGCAGG - Intergenic
1043313652 8:78893800-78893822 CCTGCATTCTACTATGATGCAGG + Intergenic
1044259283 8:90098551-90098573 CCTGCAGCCCTCTAGGGTGCAGG + Intergenic
1055773921 9:79747685-79747707 CCTGCCACCCTCTATGGTGCAGG + Intergenic
1193196529 X:78639072-78639094 CATGCCTCCCTCTATGGGGAGGG - Intergenic