ID: 1150440607

View in Genome Browser
Species Human (GRCh38)
Location 17:65188341-65188363
Sequence CTGCTCCAACAGCTTCAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 208}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150440602_1150440607 -10 Left 1150440602 17:65188328-65188350 CCCCAGTATGACCCTGCTCCAAC 0: 1
1: 0
2: 1
3: 8
4: 107
Right 1150440607 17:65188341-65188363 CTGCTCCAACAGCTTCAGCAAGG 0: 1
1: 0
2: 2
3: 22
4: 208
1150440601_1150440607 2 Left 1150440601 17:65188316-65188338 CCTGAAGCTTATCCCCAGTATGA 0: 1
1: 0
2: 0
3: 8
4: 81
Right 1150440607 17:65188341-65188363 CTGCTCCAACAGCTTCAGCAAGG 0: 1
1: 0
2: 2
3: 22
4: 208
1150440600_1150440607 3 Left 1150440600 17:65188315-65188337 CCCTGAAGCTTATCCCCAGTATG 0: 1
1: 0
2: 1
3: 7
4: 92
Right 1150440607 17:65188341-65188363 CTGCTCCAACAGCTTCAGCAAGG 0: 1
1: 0
2: 2
3: 22
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150440607 Original CRISPR CTGCTCCAACAGCTTCAGCA AGG Intronic
900153951 1:1196592-1196614 CTGCTGCATCCGCTTCTGCAGGG - Exonic
900337525 1:2171987-2172009 CTGCGCCAACAGCTCCAGCCTGG - Intronic
900352683 1:2243382-2243404 CTGCACCCACAGCTGCAGAAAGG - Intronic
903345309 1:22680561-22680583 CTTCTCCAACACCCTCAGCCAGG - Intergenic
903439930 1:23380083-23380105 TTGCCCCAACAGCTTCCCCAAGG + Intergenic
904596584 1:31650123-31650145 CTGCTCCCACAGCATCCACAGGG - Intergenic
907497423 1:54854115-54854137 CTGCTCGTACAGCTTGCGCAGGG + Exonic
909409632 1:75335085-75335107 CAGCTCCAAATGCTTTAGCATGG + Intronic
912449348 1:109759762-109759784 CATCTCGAACAGCTTCTGCAAGG + Exonic
913201191 1:116496332-116496354 CTGGTCCCACAGAATCAGCATGG + Intergenic
913718573 1:121566226-121566248 CTGGTCCAGGAGATTCAGCAAGG - Intergenic
914007494 1:143745230-143745252 TTTCTCCACAAGCTTCAGCATGG + Intergenic
914646308 1:149655712-149655734 TTTCTCCACAAGCTTCAGCATGG + Intergenic
915846268 1:159268774-159268796 CTGCTGCTACAGTTTCAGAAAGG + Intergenic
916685400 1:167140466-167140488 GTGCTCCAACAGGTACAACATGG + Intergenic
916770818 1:167905864-167905886 CTGCCCCAGCAGCTACAGGAAGG - Intronic
919924774 1:202186588-202186610 CTGCTGCAGCAGCCTCAACAGGG - Intergenic
921261903 1:213392027-213392049 CTGCTTCAAAAGCCTTAGCAGGG + Intergenic
922465475 1:225843439-225843461 CTCCTCCAAGAGCCTCAGCAGGG + Intronic
1062878178 10:958510-958532 CTGCACCAACATCCCCAGCAAGG - Intergenic
1063630362 10:7728000-7728022 CTGCTCAGACACTTTCAGCAAGG + Intronic
1066671133 10:37840967-37840989 TTGTTCCAACTGCTTCAGCTTGG - Intronic
1067114947 10:43428159-43428181 CTGCTCCATAGGCTTCAGGAGGG - Intergenic
1067542964 10:47169791-47169813 CCTCTCCAACAGCTACAGGATGG + Intergenic
1067788608 10:49271133-49271155 CTGCTCCCACAGCCTCACCCAGG - Intergenic
1068038199 10:51787680-51787702 TTGCGCCAACTCCTTCAGCAGGG - Intronic
1073207692 10:101777235-101777257 CTGCTCCCACAGAAGCAGCATGG - Intronic
1074680791 10:115904952-115904974 TTGCTTGAACAGCTTCAGCCTGG + Intronic
1076126708 10:127979845-127979867 CTGCTCCAGAAACTTCTGCATGG + Intronic
1078038354 11:7832921-7832943 CTGCTCCAACCTCTGCACCATGG - Intergenic
1079077902 11:17395191-17395213 CTTCACCACCAGCTTCAGCTGGG + Exonic
1080703730 11:34668453-34668475 CTGTTTTCACAGCTTCAGCAGGG - Intergenic
1082880448 11:58031759-58031781 CTCCTCCATCAACTTCAACAAGG + Exonic
1083897236 11:65626013-65626035 GTACTCCAGCGGCTTCAGCACGG - Exonic
1084954853 11:72685737-72685759 CAGCTGCAGCAGCTTCAGCGGGG - Intronic
1088386836 11:109267835-109267857 TTGCTGCTACATCTTCAGCAAGG - Intergenic
1090383924 11:126345576-126345598 CTCCTGCAAGAGCTTGAGCAGGG - Exonic
1090531676 11:127597330-127597352 CTGCTACCACGGCTTCAGCAGGG - Intergenic
1090839062 11:130473680-130473702 CTGCTCCAAGAGCTGCGGCCGGG + Exonic
1093795156 12:23302192-23302214 CTGCTCAAACCGCATCAGTAGGG - Intergenic
1093949467 12:25148277-25148299 CAGATCCACCATCTTCAGCAAGG + Intronic
1094374365 12:29774514-29774536 GTTCTCCAACACTTTCAGCATGG + Intronic
1096820223 12:54227923-54227945 CTGCTTCTACATCTGCAGCAAGG - Intergenic
1099607603 12:84825414-84825436 CAGCTTCTACAGCTACAGCATGG + Intergenic
1101322923 12:103689132-103689154 CTGCAGGAACAGTTTCAGCATGG - Intronic
1101726112 12:107389696-107389718 CTGCTCCAACAACGTCAGCTGGG + Intronic
1103206169 12:119130735-119130757 CTGCTCCAAGACCCTCTGCAAGG + Exonic
1106589724 13:31089007-31089029 CTCCTCAGGCAGCTTCAGCATGG + Intergenic
1107682455 13:42865932-42865954 CTACTCCACCAGCTGCAGCGAGG + Intergenic
1110921580 13:81094163-81094185 GTGCTCCAACATGTACAGCATGG - Intergenic
1112080896 13:95969014-95969036 CTGCTGGAACTGCTGCAGCATGG - Intronic
1112168183 13:96942474-96942496 CTGCTCCAAACACTTTAGCATGG + Intergenic
1112573226 13:100612478-100612500 CTCTTCCAACTGCTTCAGCTTGG + Exonic
1114065772 14:19059045-19059067 CTGCTCCCAGAGCCTGAGCATGG + Intergenic
1114096489 14:19340955-19340977 CTGCTCCCAGAGCCTGAGCATGG - Intergenic
1116714132 14:48406864-48406886 CTCTTCTCACAGCTTCAGCAGGG + Intergenic
1119264279 14:73254876-73254898 GTGCTCCAAGAGCTGCAGCTCGG + Exonic
1121037933 14:90722197-90722219 CTGCTTTAACAGCTTCAGAATGG - Intronic
1122112807 14:99513824-99513846 TTGATCCCACAGCTGCAGCACGG - Exonic
1122896046 14:104757562-104757584 CGGCTCCCATGGCTTCAGCATGG + Intronic
1128673593 15:69593159-69593181 CTGTTCCAACAGCTGCAGCCAGG + Intergenic
1128921314 15:71612566-71612588 CTCCATCAACAGCTGCAGCACGG - Intronic
1129412317 15:75356711-75356733 CAACTCCAACAGCTTCAGCGTGG - Exonic
1132086557 15:98913086-98913108 CGGCTCCAACAGCTGGAACATGG + Exonic
1132395008 15:101465978-101466000 CTGATCCAACAACGCCAGCAAGG + Intronic
1132550738 16:552967-552989 CTGCACCGACAGCTTCAACGTGG + Exonic
1132702821 16:1229300-1229322 CGGCTCCTCCAGCTCCAGCAGGG + Exonic
1132705505 16:1241568-1241590 CGGCTCCTCCAGCTCCAGCAGGG - Exonic
1134913959 16:18053578-18053600 CTCCTCCAACAGCCCCTGCAGGG + Intergenic
1135272392 16:21080690-21080712 CTGCTGCATCAGCGTCAGCTAGG - Intronic
1136547955 16:30965946-30965968 CGGCTCCATCAGCTGCGGCAGGG + Exonic
1137275178 16:46928777-46928799 CTGCTTCGACAGCTCCAGCCCGG - Intronic
1137441857 16:48504767-48504789 CTGCCCCACCAGCTTCCGCAGGG - Intergenic
1142211783 16:88811867-88811889 CTGCTCAACCAGCTGCAGCTCGG + Exonic
1142315775 16:89344061-89344083 CTGCACCAAAAGCTTCCGCTGGG - Intronic
1142502095 17:338945-338967 CTCCGCCAGCAGCTTCTGCACGG + Intronic
1144782451 17:17814847-17814869 CTTCTCCATCAGTTCCAGCATGG - Exonic
1145020171 17:19424018-19424040 CTCTTCCACCAGCTTCACCAGGG - Intergenic
1146657808 17:34645327-34645349 CTGCTTCCACAGCTTCTGCAAGG + Intergenic
1148652649 17:49260674-49260696 GGGCTCCGACAGCTTCAGCCGGG + Intergenic
1148728576 17:49815569-49815591 ATGCTCCCACAGCTCCAGAAGGG - Intronic
1148743725 17:49907237-49907259 CTGCTCCCTCAGCTTCTGGAAGG - Intergenic
1150047146 17:61925043-61925065 CTGGTATCACAGCTTCAGCATGG - Exonic
1150440607 17:65188341-65188363 CTGCTCCAACAGCTTCAGCAAGG + Intronic
1151107432 17:71632975-71632997 CTGCTGCAACTGCTTCATAAAGG + Intergenic
1151656011 17:75496333-75496355 CTACGCCACCAGCATCAGCATGG + Exonic
1151699853 17:75737368-75737390 CTGCACCTACAGCTACACCATGG + Exonic
1152388238 17:79987833-79987855 CTGCTTTAAAAGCTTCAGGATGG - Intronic
1152648765 17:81482357-81482379 CTGCATCCACAGCTTCAGCGCGG - Intergenic
1152757040 17:82091394-82091416 CTGCTCCAGCAGCTTCTGCACGG + Exonic
1152899595 17:82932706-82932728 CTGCTTCGACATCTTCACCACGG + Exonic
1153263836 18:3248266-3248288 CTGCAACAACAGCTGCAGCAGGG - Intronic
1154195425 18:12262567-12262589 CTTCTCAAAGAGTTTCAGCAAGG + Intronic
1154312586 18:13278877-13278899 ATGCTCCAAGAGCTTCAGGGGGG - Intronic
1159595972 18:70383135-70383157 TTGTTCCAGCAGCTTCACCAGGG - Intergenic
1160117931 18:76099572-76099594 CTGCTCCCACAGCCTTAGCAAGG + Intergenic
1160218237 18:76952950-76952972 CTGCTCCAACGCCACCAGCAGGG - Intronic
1160307692 18:77755491-77755513 CTGCACCACCACATTCAGCAGGG + Intergenic
1160512864 18:79462146-79462168 CTGCTCCCACATCTCCTGCACGG + Intronic
1160701065 19:507658-507680 CGCCTCCAGCACCTTCAGCAGGG - Exonic
1162923680 19:13918933-13918955 CTGCTCCAGCGCCTCCAGCAGGG - Exonic
1162966843 19:14160190-14160212 CTGCTCCATCAGCTTCACAGAGG + Exonic
1163103494 19:15110575-15110597 CTGCTCCGACAGGGTCAGCTTGG - Exonic
1163581080 19:18139103-18139125 CTGCTCCCACCGGTTCAGCAAGG + Exonic
1164657205 19:29931320-29931342 CTTTTCCAACACCTTCATCATGG - Intronic
1165318792 19:35073793-35073815 CTGCTCCAAGAGAACCAGCAGGG + Intergenic
1165450482 19:35879350-35879372 CTGCTCCTCCAGGGTCAGCATGG - Exonic
1166849906 19:45754671-45754693 CAGATCCAACAGCGTCAGCTGGG - Exonic
1166993375 19:46706440-46706462 CTGCAAGAAGAGCTTCAGCAGGG + Intronic
1167356803 19:49009656-49009678 CTGCTTCCACAGCTTCAAAATGG - Intronic
927889301 2:26738479-26738501 CTGCTTCAGCAGCTTCTGGAAGG + Intergenic
928422999 2:31154244-31154266 CTGCTCCCATAACTTCAGCTTGG + Intronic
929556666 2:42929828-42929850 CTGCTCTCACAGCTTCACAAAGG - Intergenic
931290421 2:60868426-60868448 CTACTCTAACATCTTCAGTATGG + Intergenic
932766684 2:74474959-74474981 CTGCTGCAACAGACACAGCAGGG + Exonic
933460254 2:82574119-82574141 CTGCTCTAACATCTTTTGCAGGG + Intergenic
938483176 2:131679174-131679196 CTGCTCCCAGAGCCTGAGCATGG + Intergenic
941402320 2:165045674-165045696 CTGCTCCAAGAACTACTGCAGGG - Intergenic
941405505 2:165082901-165082923 CTGCTCCAAGGGCTACACCAAGG - Intergenic
942568214 2:177287706-177287728 CTGCTGCACCAGTTTCAGCTGGG + Intronic
942879543 2:180842603-180842625 CTGCTAGAACAGCTTCATCAGGG - Intergenic
946609704 2:221444398-221444420 GTGCCCCAACAGCTCCAGGAGGG - Intronic
947930267 2:233958985-233959007 CAGCTCCAACAACATCAACATGG - Intronic
949077580 2:242070813-242070835 CTGCTCCACCAGCCCCAGCAGGG + Intergenic
1168734805 20:123834-123856 TTGATCCAAGAACTTCAGCAAGG + Intergenic
1169014346 20:2279613-2279635 CTGGGCCTACAGCTGCAGCATGG - Intergenic
1169114115 20:3051876-3051898 CAGTTCCAACAGCAGCAGCAGGG - Intergenic
1170110001 20:12794900-12794922 CTGCTCTAAAATATTCAGCAAGG - Intergenic
1170733649 20:18994982-18995004 CTTCAACAACAGCATCAGCAAGG - Intergenic
1172224696 20:33297505-33297527 CAGCTGCAACAGCATAAGCAAGG - Exonic
1172331095 20:34076765-34076787 CTGCTCCAAGCGGCTCAGCAGGG - Exonic
1173918528 20:46726922-46726944 CTTCTGCAACAGCTTCAACTGGG + Exonic
1174619331 20:51862283-51862305 CTGCTGCACCAGCCTCAGAAGGG - Intergenic
1174944714 20:54972101-54972123 CTGCTTCCACAGCTACAGCATGG + Intergenic
1176014180 20:62920391-62920413 CTGCTGCAAAGGATTCAGCAAGG + Intronic
1177173274 21:17677082-17677104 CTGCTCCAGCAGCTTCTGGTGGG - Intergenic
1178147288 21:29754828-29754850 CTGCAGCATCAGCTTCAGCCTGG + Intronic
1180484254 22:15781637-15781659 CTGCTCCCAGAGCCTGAGCATGG + Intergenic
1181008472 22:20026097-20026119 CAGATCCAAGAGCTTCACCAAGG + Intronic
1181115544 22:20630934-20630956 CAGCACCAACAGCTTCAGAGAGG + Intergenic
1181486161 22:23232998-23233020 GTGCTCTAATAGCTTCAGCCTGG + Intronic
1181551355 22:23640591-23640613 CAGCACCAACAGCTTCAGAGAGG - Intergenic
1181796908 22:25318070-25318092 CAGCACCAACAGCTTCAGAGAGG + Intergenic
1183474745 22:38029983-38030005 CTGCTGCAACAGCCTCACCTTGG - Intronic
1183927626 22:41217255-41217277 CTCCTCCACCTGCTTCACCAGGG + Intronic
1184102330 22:42347407-42347429 CTGCTCCAGCAGATGCAGCCTGG + Intergenic
952968669 3:38637054-38637076 CTGCTCCATCTGCATCAGCTTGG + Intronic
953687198 3:45087282-45087304 CTCCTACAACAGCTTGGGCACGG + Intronic
954144572 3:48628174-48628196 CTGTTCCAGGAGCTTCAGCCTGG - Intronic
954351229 3:50045887-50045909 CTACTCCATGACCTTCAGCAAGG - Intronic
954445149 3:50542402-50542424 CTGCCCCAGCAGCTTCTACAGGG + Intergenic
954792176 3:53141613-53141635 CTGCTCCATCAGCTCCTACAAGG - Intergenic
957186872 3:76952777-76952799 CTCCTCCAGCATGTTCAGCAGGG + Intronic
957321729 3:78639792-78639814 CTGCTCCATCAGCTGCTGCACGG - Exonic
959388816 3:105747287-105747309 CTGCTTTAACAGCTTTAACATGG - Intronic
962343549 3:134604106-134604128 CTGCTCCATCAGCTTCAGCGTGG - Exonic
963326300 3:143866925-143866947 CTGCTCCACCAGCTTCTGCTGGG - Intergenic
963912580 3:150827209-150827231 GTGCCCTTACAGCTTCAGCAGGG + Intergenic
965221233 3:165929235-165929257 GTGCTACAACAGCTACAGGATGG - Intergenic
965689781 3:171343240-171343262 CTGCTGCATCAGCCTCAACAGGG + Intronic
967281962 3:187831567-187831589 CTGTTTCATCAGCTTCAGAATGG + Intergenic
969238517 4:5884849-5884871 CAGAGCCAACAGCTTCTGCAGGG + Intronic
969289605 4:6230288-6230310 CTGCTCCAGCAGGTTCAGGGTGG + Intergenic
971095552 4:23398559-23398581 CTGCTGCAATATCTGCAGCAGGG + Intergenic
971423392 4:26493701-26493723 CTGCTTCAACTGCTCCAGCTGGG + Intergenic
975666869 4:76741400-76741422 CTGCTGGAACTGCTTCAGCTCGG - Exonic
975760062 4:77611174-77611196 TTGCCCCATCAGCTTCTGCAAGG - Exonic
976211500 4:82676179-82676201 CTGCTCTACCATCCTCAGCAGGG - Intronic
979267900 4:118724939-118724961 CTGCTTCACCAGCTGCAGCAGGG + Intronic
983763196 4:171440195-171440217 CTGCTCCAACACCTCCTGCCAGG + Intergenic
984229193 4:177073862-177073884 CTGGTCCAACAGATTAAGAAAGG - Intergenic
984437901 4:179727391-179727413 CAGCTTCAGCAGCTTCAGAATGG - Intergenic
986954411 5:13133867-13133889 CACCTCCAGCAGCTTAAGCATGG + Intergenic
987313401 5:16701629-16701651 CCGCTCCTGCAGCTTCTGCAGGG + Exonic
988781499 5:34526852-34526874 CTATTGCAACAGCATCAGCAGGG + Intergenic
989033946 5:37150081-37150103 CCTCCCCAACAGATTCAGCAGGG + Intronic
989960020 5:50401828-50401850 CTGATCCAGGAGATTCAGCAAGG + Intronic
992000683 5:72433085-72433107 CTACTACACCATCTTCAGCAAGG - Intergenic
992407304 5:76472046-76472068 CTGCCCCACCAGCTGCCGCATGG - Intronic
994358939 5:98828031-98828053 ATGCTCCATCAGCTGTAGCAGGG - Intergenic
994719773 5:103367131-103367153 CTGCACCACCAGCCTGAGCAAGG + Intergenic
997225007 5:132203296-132203318 TTGCTCCAAAAGCAGCAGCAGGG - Intronic
997248564 5:132371462-132371484 CTGCTCCAACAGGTTCGGAGGGG - Intronic
997560016 5:134838257-134838279 TTTCTCCAAAAGCTTCAGCCTGG - Intronic
998814680 5:146001321-146001343 CTGCTACAATAGCTTAGGCAAGG + Intronic
1004474866 6:15961883-15961905 CTGATCCAATAGCTTGAGAAGGG - Intergenic
1004961958 6:20800107-20800129 CTGGTCCAGCAGTTCCAGCAGGG - Intronic
1006635825 6:35460466-35460488 CTGCTCCAACTCCCACAGCAGGG - Intronic
1007249393 6:40485562-40485584 CTCCTCCAACATCGACAGCAAGG + Intronic
1008568439 6:52792082-52792104 CTGCTCCATCAGCACAAGCATGG + Intronic
1013159655 6:107529708-107529730 TTTCTCAAACAACTTCAGCAGGG + Intronic
1013300481 6:108800619-108800641 GTGCTCCTTCAGCTTCAGCCTGG + Intergenic
1013309995 6:108884827-108884849 CTGCTACAACAGCTTCCCAATGG - Intronic
1019796755 7:3055430-3055452 CTGATCCTGCAGCTGCAGCATGG - Intergenic
1019888426 7:3925415-3925437 TTGCCCTAACAGCTTGAGCAGGG - Intronic
1021157709 7:17232113-17232135 CTGCTCTAACAGCTTTGGCCAGG + Intergenic
1022199435 7:28102217-28102239 CTGCTCCAACATTTGCTGCAAGG + Intronic
1022965027 7:35464818-35464840 CTGCTGCAACACCTCCAGCGTGG + Intergenic
1023868704 7:44251485-44251507 CTGGTGCGACAGCCTCAGCATGG - Intronic
1024799701 7:53061922-53061944 CTGCTCCACCAGTTCCTGCAAGG + Intergenic
1025708942 7:63890540-63890562 CTGCTCCCACAGCCTCATCTGGG - Intergenic
1026035172 7:66825315-66825337 CAGCTCCACCTGCTTCCGCAGGG + Intergenic
1026984366 7:74545768-74545790 CAGCTCCACCTGCTTCCGCAGGG - Exonic
1028640223 7:93034038-93034060 CTGATAAAACAACTTCAGCAAGG + Intergenic
1032539545 7:132691943-132691965 CAGCTGCAAGAGGTTCAGCAGGG - Intronic
1033268923 7:139913311-139913333 TTGCTCCATCAGCCTCAGCAAGG + Intronic
1035536135 8:392698-392720 CTGCTCCACCAGCCCCAGCAGGG + Intergenic
1040480278 8:47819151-47819173 CTACTCCAAAAGCTTCATTAAGG + Intronic
1044048686 8:87471966-87471988 CTTATCCAACACCTTCAGTAAGG + Intronic
1047435545 8:124832851-124832873 GTGCTACACCAGCATCAGCAAGG + Intergenic
1048019624 8:130526439-130526461 CTGTTCCTTCAGCTTCATCATGG - Intergenic
1049614028 8:143568606-143568628 CTGCAGCACCAGCTTCCGCAGGG + Exonic
1049804022 8:144530846-144530868 CCGGTACCACAGCTTCAGCAGGG + Exonic
1055112960 9:72577589-72577611 CTTTGCCAAAAGCTTCAGCAAGG - Intronic
1057221387 9:93259586-93259608 CTGCTCCAGCTGCTACACCAGGG + Exonic
1057694665 9:97314619-97314641 CTTATCCCACAGCTCCAGCAGGG - Exonic
1057953109 9:99385745-99385767 GTGCTCCAACAGAATGAGCAGGG + Intergenic
1059856426 9:118403228-118403250 CTGCTCTGACAGCTTATGCAGGG - Intergenic
1060062319 9:120471818-120471840 CTGCTCCAGTTGCTTCCGCAGGG + Exonic
1060984161 9:127810087-127810109 CACCTGCAGCAGCTTCAGCAGGG - Exonic
1061137217 9:128741818-128741840 CTTCTGAATCAGCTTCAGCATGG + Exonic
1061493987 9:130961325-130961347 CTGCACCACCAGCGTCAGCAGGG - Intergenic
1062491255 9:136806172-136806194 CAGCTCCAGCTGCTTCACCAGGG - Exonic
1187311794 X:18151585-18151607 CTGCTGCTACAGCTACTGCAGGG + Intergenic
1187497842 X:19811776-19811798 CAACCCCAAGAGCTTCAGCATGG + Intronic
1188433607 X:30135197-30135219 CTGTTCCAACAGCATCAACAAGG + Intergenic
1188527357 X:31100763-31100785 CTGCTGCTTCAGCTTCAGTAAGG + Intronic
1189840630 X:45072618-45072640 CTGCTCTAACTGCTGGAGCAGGG + Intronic
1190296397 X:49030172-49030194 CCGCCGCAGCAGCTTCAGCATGG - Exonic
1192220037 X:69191664-69191686 ATGCTCCCACAGCTTCTGCTGGG + Intergenic
1192340967 X:70263058-70263080 CTGCTCCTACTGCTTCAGGCTGG + Intergenic
1196405375 X:115356606-115356628 CAGTTTCAACAGCTTCAGAAAGG - Intergenic
1201682706 Y:16666459-16666481 ATGTTCCAATAGCATCAGCAGGG - Intergenic