ID: 1150440924

View in Genome Browser
Species Human (GRCh38)
Location 17:65190731-65190753
Sequence TCTCCTAGATGATGTCCTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 137}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150440924 Original CRISPR TCTCCTAGATGATGTCCTAT GGG (reversed) Intronic
904767964 1:32864753-32864775 TGTCCTTGATGATGTCATACTGG + Exonic
905884389 1:41484057-41484079 TCACCCAGATGATGTCCAAGTGG + Exonic
907122546 1:52020038-52020060 ACTCCTAGATTAGGTCCTCTAGG + Intergenic
908010085 1:59767194-59767216 TTTCCTGTATGATATCCTATGGG + Intronic
912648575 1:111418280-111418302 TCCCCTCTCTGATGTCCTATGGG + Intronic
917424569 1:174900860-174900882 TCTCCTGGATGATATCCTGAAGG + Intronic
920225181 1:204433411-204433433 CCTTCTAGATGTTGTCCTGTGGG - Exonic
923201226 1:231713659-231713681 TCTGCTTCATGATGTCCTAGAGG - Intronic
923294164 1:232577014-232577036 TCTATTAGAAGACGTCCTATAGG + Intergenic
923958867 1:239054622-239054644 TCTCCTAGATGATCCCAGATGGG + Intergenic
924625172 1:245691302-245691324 TCTCGTAAATGCTGTCCTCTAGG + Intronic
1063821040 10:9836137-9836159 TCTCCTAGATAATGTCTTTGTGG - Intergenic
1064601608 10:16999248-16999270 TCTCTTTGATGATGTACTAAAGG - Intronic
1064716703 10:18183775-18183797 TCTCCTAGATGTGAACCTATGGG + Intronic
1068291570 10:55008368-55008390 TCAGCTAGATCATTTCCTATGGG + Intronic
1069508623 10:69023374-69023396 TCTCCTTGATGATGTCACACAGG - Intergenic
1077730659 11:4725937-4725959 CCTCTTAGATGATGTCCAGTAGG + Intronic
1078356245 11:10633751-10633773 TCTCCTGGATGTGGTCCTTTTGG - Intronic
1078834663 11:15015769-15015791 TCTCCTGGATGATATCCTGCTGG - Intronic
1079396010 11:20064300-20064322 TCTCCTAAATTATATCCTAGGGG - Intronic
1079642272 11:22820943-22820965 TCTCCTAAATTATTTACTATGGG + Exonic
1085702441 11:78756917-78756939 TCTCCTGGATGATGTCCAGAGGG + Exonic
1086744677 11:90410177-90410199 TCTTCTAAATGATGCCCTAAAGG - Intergenic
1086842579 11:91705841-91705863 TTTCCTAGTTGAGGTTCTATAGG - Intergenic
1094319099 12:29165891-29165913 TGTCCTAGATGTTGTTGTATAGG + Intronic
1095186760 12:39209304-39209326 TCTCCTGGATAATGTCCTGAAGG - Intergenic
1096796095 12:54078436-54078458 TCTCCTAGCTGGTTTCCTAGAGG + Intergenic
1102694822 12:114790695-114790717 TGGCCCAGATGATGTCCTTTTGG - Intergenic
1103854444 12:123956287-123956309 TTTCCTAGATCATTTCCTAGAGG + Intronic
1108448948 13:50540856-50540878 TCTCCTAGAAAATGTTCTGTAGG + Intronic
1109034011 13:57231499-57231521 TCTCCTGGATAATATCCTAAAGG - Intergenic
1109255772 13:60079627-60079649 TATCACAGATGATGTCTTATGGG + Intronic
1110988870 13:82011449-82011471 TATGTTAGATGATCTCCTATGGG + Intergenic
1112799294 13:103092830-103092852 TCCACTAGATGATGTCCCAGTGG + Intergenic
1113059428 13:106306292-106306314 CCTCCTACATGATGTAGTATGGG + Intergenic
1113742824 13:112723243-112723265 TCACGCAGATGATGTCTTATTGG + Intronic
1116602851 14:46949264-46949286 TCTTCTGGATGATGTACTGTGGG - Intronic
1116965460 14:51010323-51010345 CATCCTAGACTATGTCCTATGGG + Intronic
1117422293 14:55558767-55558789 GCTCTTAGATGATTTACTATGGG + Intergenic
1118483207 14:66188297-66188319 TCTCCTGGATAATGTCCTGCAGG + Intergenic
1124009503 15:25826175-25826197 TTTGCTTGATGATGTCCTACGGG - Intronic
1124423305 15:29540915-29540937 TATCCTAGATGATGTCCTAGTGG + Intronic
1125904670 15:43379984-43380006 TCTCCTAGATTGTGCCCTCTTGG + Intronic
1128273698 15:66334788-66334810 TCTTCTAGCTGATCCCCTATTGG + Intergenic
1139209574 16:65064146-65064168 GCTCCTAGATAAGGTCCTCTGGG - Intronic
1145236501 17:21212176-21212198 TCTCCTAGATAACGTGGTATGGG - Intronic
1145905727 17:28515132-28515154 TCTCCTTGAGGATGTCCTCAGGG + Intronic
1146733310 17:35214510-35214532 TGTGCTAGGTGATGTACTATGGG + Intergenic
1150440924 17:65190731-65190753 TCTCCTAGATGATGTCCTATGGG - Intronic
1153657800 18:7300620-7300642 TACACTTGATGATGTCCTATAGG + Intergenic
1154277131 18:12971803-12971825 TCACCTAGAAGATGACCTATAGG + Intronic
1156235412 18:35198805-35198827 ACTCCTAGCTTATGTCCTACTGG - Intergenic
1158253935 18:55524200-55524222 TCTACTAGATCACGTCCTGTTGG + Intronic
1159202193 18:65201878-65201900 TTTCCTAGAAGATGCCCTAAGGG + Intergenic
1160373723 18:78395327-78395349 GCTCCTAGAAGATGTCCAACTGG + Intergenic
1168643519 19:58045371-58045393 TCTCCTGGATGGTGTCCTGGAGG - Intronic
926259168 2:11241339-11241361 TCTGCTTGATGTTGTCCCATAGG - Intronic
930472741 2:51840739-51840761 TCCACTTGATGATGTCTTATAGG + Intergenic
930495213 2:52132923-52132945 TATCCTAGAGAATGTCCTTTAGG + Intergenic
937732208 2:125246768-125246790 TCACCTAGATGATCTCTTCTTGG + Intergenic
944957187 2:204825406-204825428 TCTCCTAGATGAAGGCAAATAGG + Intronic
947985903 2:234447249-234447271 TCTCATAGATGAAGTCCTCCTGG + Intergenic
1169379780 20:5096421-5096443 TCTCCTAGATTCAGTCCCATAGG - Intronic
1171847599 20:30286474-30286496 TCTCCTAGCTGGTTTCCTAGAGG + Intergenic
1172357707 20:34291464-34291486 TCTACAAGATGATGGCCAATGGG - Exonic
1172822164 20:37746489-37746511 TCTCCTGAATGATGTCATTTAGG - Exonic
1173776880 20:45715908-45715930 TCTCCTGGATGATATCCTGAAGG - Intergenic
1177332142 21:19678689-19678711 TCTCCTGGATGATATCCTGAAGG + Intergenic
1178480935 21:32978809-32978831 TCTCCGAGATGAAGTACAATAGG + Intergenic
1180557418 22:16589155-16589177 TCTCCTAGATTCTGTCCCATAGG + Intergenic
1182709220 22:32310237-32310259 TGTCCTGGATGATGCTCTATAGG - Intergenic
1183707363 22:39482468-39482490 CCTCCTTAATGATGTCCTTTGGG + Intronic
1185256367 22:49835176-49835198 TCTCCTCCAGGATGTCCTGTAGG + Intergenic
949787733 3:7760158-7760180 TTTACTAGATCATCTCCTATTGG + Intergenic
950012626 3:9733886-9733908 TCTCCTACATGATGTGAGATTGG + Intronic
952253585 3:31677018-31677040 TCTCCTAAATCATGGCCTTTAGG - Intronic
954927780 3:54252419-54252441 TGTCTTAGCTGATGTCCAATAGG + Intronic
956621476 3:71225395-71225417 TATCCTAGATGATGTGATTTGGG - Intronic
958440442 3:94149968-94149990 TCTCTTAGATTATTTCCTTTAGG + Intergenic
959208111 3:103339660-103339682 TCTTGTGTATGATGTCCTATAGG - Intergenic
960914499 3:122681906-122681928 TCTTATGGATGATGACCTATCGG + Intronic
963949580 3:151184492-151184514 ACTTGTAGTTGATGTCCTATTGG + Intronic
967481128 3:189974593-189974615 TCTCCTGGATAACGTCCTGTCGG - Exonic
968668545 4:1834910-1834932 TCTCCTCGATGGTGTCCTGGAGG + Exonic
971228585 4:24778696-24778718 TCTCATAAATGATGTGCTGTGGG + Intergenic
972255718 4:37353411-37353433 TCTCCTGGATAATATCCTAAAGG + Intronic
973160959 4:47015879-47015901 TCTACTAGATTATGACCTCTAGG - Intronic
975057439 4:69951755-69951777 TTTCCCAGGTGATGTCATATGGG + Intergenic
978130505 4:105190460-105190482 CTTCCTGGATCATGTCCTATTGG - Exonic
981280869 4:142956527-142956549 TATCCTTTATGTTGTCCTATAGG - Intergenic
983795488 4:171856508-171856530 TCACCTAGATTCTCTCCTATAGG + Intronic
987540572 5:19249397-19249419 TTTCCTAAATGAAGTCTTATTGG - Intergenic
990530933 5:56672884-56672906 TCTCCTAGTTGATTTCCTTGAGG - Intergenic
992079029 5:73216666-73216688 TGTTCTAAATGATGTCCTTTAGG - Intergenic
993687616 5:90959571-90959593 TAACCTAGATGATGTAGTATTGG + Intronic
994368207 5:98940289-98940311 TCTCCATGTTGTTGTCCTATGGG + Intergenic
994721408 5:103384758-103384780 TCTCCTGGATAATGTCCTTAAGG + Intergenic
995922086 5:117326740-117326762 TCTCATTGATGATGTCCCAGTGG + Intergenic
998886410 5:146699326-146699348 TGCCCTAGATGATGTCACATGGG + Intronic
1001591931 5:172871554-172871576 TCACCTAGATTATCTCCTAGTGG - Intronic
1003611941 6:7621722-7621744 TCTCATAGATGATTTACTATGGG - Intergenic
1003751217 6:9058983-9059005 TGTCTTAGATGATGTTCTTTTGG - Intergenic
1005534594 6:26743138-26743160 TCTCCAAGATTATTTCCAATAGG - Intergenic
1008789647 6:55214934-55214956 TCTACTTGATGATGTCCTTAGGG - Intronic
1015032847 6:128616659-128616681 TCTGCTTGATGATGTGCTACAGG + Intergenic
1017393543 6:153969248-153969270 TCTGCTAGATGATAGCCTCTTGG - Intergenic
1023321003 7:38997572-38997594 TCCCCTTGATGATGACCTCTAGG + Intronic
1023369631 7:39500045-39500067 TCTACTTGCTGATGTCCTCTGGG + Intergenic
1031114862 7:117656446-117656468 TTTCCTATATAATGTCCTAATGG - Intronic
1031274290 7:119698442-119698464 TCTACCTGATAATGTCCTATTGG - Intergenic
1033524170 7:142193932-142193954 TCTCATTTATGATGTCCCATAGG + Intronic
1034619910 7:152448853-152448875 TCTCCTAGATTCTGTCCCATAGG - Intergenic
1034719320 7:153274603-153274625 TTATCTAGATGATGTTCTATGGG + Intergenic
1036726543 8:11225768-11225790 TCTCCTAAATGCCGTGCTATAGG + Intergenic
1041629516 8:60070207-60070229 TCTCCTATATAATGCCCTGTGGG + Intergenic
1042531463 8:69820171-69820193 TCCTCTAGAGGATGTCCTATTGG - Intronic
1043564471 8:81533082-81533104 CCTCCTTGAAGATGTCGTATTGG + Intergenic
1044680428 8:94772464-94772486 TCTCCTGGACCTTGTCCTATGGG - Intronic
1044774355 8:95672562-95672584 TTTCCTAGATGATCTCCTTAGGG - Intergenic
1045173548 8:99696647-99696669 TCTCCTCGATGGTGTCCTGGAGG - Intronic
1045200084 8:99971673-99971695 TCTCCTTGAAGATGTCCTTCAGG - Intronic
1047357424 8:124136702-124136724 TTTTCTAGATAATTTCCTATGGG + Intergenic
1047855783 8:128910117-128910139 TCTCCTTGAAGGTGTCCTACAGG - Intergenic
1048411506 8:134179014-134179036 TCTGCTTGATGATGTCCCACAGG + Intergenic
1048668670 8:136692699-136692721 TCTACTATATTATGTCCAATAGG + Intergenic
1049311145 8:141934592-141934614 TGTCCTAGATGCTGTCCTTGTGG - Intergenic
1051292605 9:15560296-15560318 TCTCCTGGATGATATCCTGAAGG + Intronic
1051484641 9:17594721-17594743 TCTCCTTGATGGTATCCTCTAGG + Intronic
1052160284 9:25248911-25248933 TCTGCTTGATGGTGTCCTACAGG - Intergenic
1053785702 9:41651112-41651134 TCTCCTAGCTGGTTTCCTAGAGG + Intergenic
1054159330 9:61663067-61663089 TCTCCTAGCTGGTTTCCTAGAGG - Intergenic
1054449275 9:65394123-65394145 TCTCCTAGCTGGTTTCCTAGAGG + Intergenic
1054479104 9:65594072-65594094 TCTCCTAGCTGGTTTCCTAGAGG - Intergenic
1058646725 9:107137863-107137885 TCTCCTAGGCAATGTCCAATTGG - Intergenic
1059610125 9:115883624-115883646 TCTGCTAGATGATGACAGATGGG - Intergenic
1185615996 X:1422446-1422468 TCTCCTAGGTTATATCCTAGGGG + Intronic
1188795970 X:34465657-34465679 TCTCTTGGATGATGTCTTCTTGG - Intergenic
1189541720 X:41998828-41998850 TTTCCTTTATGATGTCCTTTAGG + Intergenic
1190255526 X:48759600-48759622 TCTTCTACAGGATGTGCTATAGG + Intergenic
1190323658 X:49193349-49193371 TCTCCTTGATAATGTTCTCTGGG + Exonic
1192689303 X:73344879-73344901 TCACCTATATAATGTCCTGTAGG - Intergenic
1200325054 X:155229126-155229148 TCCCCTAGCTGCTGTCCTGTAGG + Intronic
1200977111 Y:9224827-9224849 TCTCCTTGATCGTGTCCTACTGG - Intergenic
1202133986 Y:21641152-21641174 TCTTCTTGATGGTGTCCTACTGG + Intergenic