ID: 1150447448

View in Genome Browser
Species Human (GRCh38)
Location 17:65238099-65238121
Sequence AAAAGAGACACTTCTCCCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150447448_1150447460 30 Left 1150447448 17:65238099-65238121 CCTTAGGGAGAAGTGTCTCTTTT No data
Right 1150447460 17:65238152-65238174 CCTTCAGGAATTTCACCTGATGG No data
1150447448_1150447455 15 Left 1150447448 17:65238099-65238121 CCTTAGGGAGAAGTGTCTCTTTT No data
Right 1150447455 17:65238137-65238159 CCTGCCCTGGGCAGCCCTTCAGG No data
1150447448_1150447449 2 Left 1150447448 17:65238099-65238121 CCTTAGGGAGAAGTGTCTCTTTT No data
Right 1150447449 17:65238124-65238146 CGAGTCCCCTTTTCCTGCCCTGG No data
1150447448_1150447450 3 Left 1150447448 17:65238099-65238121 CCTTAGGGAGAAGTGTCTCTTTT No data
Right 1150447450 17:65238125-65238147 GAGTCCCCTTTTCCTGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150447448 Original CRISPR AAAAGAGACACTTCTCCCTA AGG (reversed) Intergenic