ID: 1150447451

View in Genome Browser
Species Human (GRCh38)
Location 17:65238129-65238151
Sequence GCTGCCCAGGGCAGGAAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150447451_1150447461 3 Left 1150447451 17:65238129-65238151 CCCCTTTTCCTGCCCTGGGCAGC No data
Right 1150447461 17:65238155-65238177 TCAGGAATTTCACCTGATGGAGG No data
1150447451_1150447462 4 Left 1150447451 17:65238129-65238151 CCCCTTTTCCTGCCCTGGGCAGC No data
Right 1150447462 17:65238156-65238178 CAGGAATTTCACCTGATGGAGGG No data
1150447451_1150447466 17 Left 1150447451 17:65238129-65238151 CCCCTTTTCCTGCCCTGGGCAGC No data
Right 1150447466 17:65238169-65238191 TGATGGAGGGGTCTTAGGTCTGG No data
1150447451_1150447463 5 Left 1150447451 17:65238129-65238151 CCCCTTTTCCTGCCCTGGGCAGC No data
Right 1150447463 17:65238157-65238179 AGGAATTTCACCTGATGGAGGGG No data
1150447451_1150447464 12 Left 1150447451 17:65238129-65238151 CCCCTTTTCCTGCCCTGGGCAGC No data
Right 1150447464 17:65238164-65238186 TCACCTGATGGAGGGGTCTTAGG No data
1150447451_1150447460 0 Left 1150447451 17:65238129-65238151 CCCCTTTTCCTGCCCTGGGCAGC No data
Right 1150447460 17:65238152-65238174 CCTTCAGGAATTTCACCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150447451 Original CRISPR GCTGCCCAGGGCAGGAAAAG GGG (reversed) Intergenic