ID: 1150447452

View in Genome Browser
Species Human (GRCh38)
Location 17:65238130-65238152
Sequence GGCTGCCCAGGGCAGGAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150447452_1150447462 3 Left 1150447452 17:65238130-65238152 CCCTTTTCCTGCCCTGGGCAGCC No data
Right 1150447462 17:65238156-65238178 CAGGAATTTCACCTGATGGAGGG No data
1150447452_1150447463 4 Left 1150447452 17:65238130-65238152 CCCTTTTCCTGCCCTGGGCAGCC No data
Right 1150447463 17:65238157-65238179 AGGAATTTCACCTGATGGAGGGG No data
1150447452_1150447460 -1 Left 1150447452 17:65238130-65238152 CCCTTTTCCTGCCCTGGGCAGCC No data
Right 1150447460 17:65238152-65238174 CCTTCAGGAATTTCACCTGATGG No data
1150447452_1150447464 11 Left 1150447452 17:65238130-65238152 CCCTTTTCCTGCCCTGGGCAGCC No data
Right 1150447464 17:65238164-65238186 TCACCTGATGGAGGGGTCTTAGG No data
1150447452_1150447461 2 Left 1150447452 17:65238130-65238152 CCCTTTTCCTGCCCTGGGCAGCC No data
Right 1150447461 17:65238155-65238177 TCAGGAATTTCACCTGATGGAGG No data
1150447452_1150447466 16 Left 1150447452 17:65238130-65238152 CCCTTTTCCTGCCCTGGGCAGCC No data
Right 1150447466 17:65238169-65238191 TGATGGAGGGGTCTTAGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150447452 Original CRISPR GGCTGCCCAGGGCAGGAAAA GGG (reversed) Intergenic