ID: 1150447454

View in Genome Browser
Species Human (GRCh38)
Location 17:65238137-65238159
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150447454_1150447467 25 Left 1150447454 17:65238137-65238159 CCTGCCCTGGGCAGCCCTTCAGG No data
Right 1150447467 17:65238185-65238207 GGTCTGGTTTTCCAAGCCTTTGG No data
1150447454_1150447463 -3 Left 1150447454 17:65238137-65238159 CCTGCCCTGGGCAGCCCTTCAGG No data
Right 1150447463 17:65238157-65238179 AGGAATTTCACCTGATGGAGGGG No data
1150447454_1150447460 -8 Left 1150447454 17:65238137-65238159 CCTGCCCTGGGCAGCCCTTCAGG No data
Right 1150447460 17:65238152-65238174 CCTTCAGGAATTTCACCTGATGG No data
1150447454_1150447462 -4 Left 1150447454 17:65238137-65238159 CCTGCCCTGGGCAGCCCTTCAGG No data
Right 1150447462 17:65238156-65238178 CAGGAATTTCACCTGATGGAGGG No data
1150447454_1150447461 -5 Left 1150447454 17:65238137-65238159 CCTGCCCTGGGCAGCCCTTCAGG No data
Right 1150447461 17:65238155-65238177 TCAGGAATTTCACCTGATGGAGG No data
1150447454_1150447464 4 Left 1150447454 17:65238137-65238159 CCTGCCCTGGGCAGCCCTTCAGG No data
Right 1150447464 17:65238164-65238186 TCACCTGATGGAGGGGTCTTAGG No data
1150447454_1150447466 9 Left 1150447454 17:65238137-65238159 CCTGCCCTGGGCAGCCCTTCAGG No data
Right 1150447466 17:65238169-65238191 TGATGGAGGGGTCTTAGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150447454 Original CRISPR CCTGAAGGGCTGCCCAGGGC AGG (reversed) Intergenic