ID: 1150447458

View in Genome Browser
Species Human (GRCh38)
Location 17:65238151-65238173
Sequence CATCAGGTGAAATTCCTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150447458_1150447464 -10 Left 1150447458 17:65238151-65238173 CCCTTCAGGAATTTCACCTGATG No data
Right 1150447464 17:65238164-65238186 TCACCTGATGGAGGGGTCTTAGG No data
1150447458_1150447468 19 Left 1150447458 17:65238151-65238173 CCCTTCAGGAATTTCACCTGATG No data
Right 1150447468 17:65238193-65238215 TTTCCAAGCCTTTGGACCACAGG No data
1150447458_1150447467 11 Left 1150447458 17:65238151-65238173 CCCTTCAGGAATTTCACCTGATG No data
Right 1150447467 17:65238185-65238207 GGTCTGGTTTTCCAAGCCTTTGG No data
1150447458_1150447466 -5 Left 1150447458 17:65238151-65238173 CCCTTCAGGAATTTCACCTGATG No data
Right 1150447466 17:65238169-65238191 TGATGGAGGGGTCTTAGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150447458 Original CRISPR CATCAGGTGAAATTCCTGAA GGG (reversed) Intergenic