ID: 1150447459

View in Genome Browser
Species Human (GRCh38)
Location 17:65238152-65238174
Sequence CCATCAGGTGAAATTCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150447459_1150447466 -6 Left 1150447459 17:65238152-65238174 CCTTCAGGAATTTCACCTGATGG No data
Right 1150447466 17:65238169-65238191 TGATGGAGGGGTCTTAGGTCTGG No data
1150447459_1150447467 10 Left 1150447459 17:65238152-65238174 CCTTCAGGAATTTCACCTGATGG No data
Right 1150447467 17:65238185-65238207 GGTCTGGTTTTCCAAGCCTTTGG No data
1150447459_1150447468 18 Left 1150447459 17:65238152-65238174 CCTTCAGGAATTTCACCTGATGG No data
Right 1150447468 17:65238193-65238215 TTTCCAAGCCTTTGGACCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150447459 Original CRISPR CCATCAGGTGAAATTCCTGA AGG (reversed) Intergenic