ID: 1150447460

View in Genome Browser
Species Human (GRCh38)
Location 17:65238152-65238174
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150447451_1150447460 0 Left 1150447451 17:65238129-65238151 CCCCTTTTCCTGCCCTGGGCAGC No data
Right 1150447460 17:65238152-65238174 CCTTCAGGAATTTCACCTGATGG No data
1150447453_1150447460 -2 Left 1150447453 17:65238131-65238153 CCTTTTCCTGCCCTGGGCAGCCC No data
Right 1150447460 17:65238152-65238174 CCTTCAGGAATTTCACCTGATGG No data
1150447448_1150447460 30 Left 1150447448 17:65238099-65238121 CCTTAGGGAGAAGTGTCTCTTTT No data
Right 1150447460 17:65238152-65238174 CCTTCAGGAATTTCACCTGATGG No data
1150447452_1150447460 -1 Left 1150447452 17:65238130-65238152 CCCTTTTCCTGCCCTGGGCAGCC No data
Right 1150447460 17:65238152-65238174 CCTTCAGGAATTTCACCTGATGG No data
1150447454_1150447460 -8 Left 1150447454 17:65238137-65238159 CCTGCCCTGGGCAGCCCTTCAGG No data
Right 1150447460 17:65238152-65238174 CCTTCAGGAATTTCACCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150447460 Original CRISPR CCTTCAGGAATTTCACCTGA TGG Intergenic
No off target data available for this crispr