ID: 1150447462

View in Genome Browser
Species Human (GRCh38)
Location 17:65238156-65238178
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150447451_1150447462 4 Left 1150447451 17:65238129-65238151 CCCCTTTTCCTGCCCTGGGCAGC No data
Right 1150447462 17:65238156-65238178 CAGGAATTTCACCTGATGGAGGG No data
1150447452_1150447462 3 Left 1150447452 17:65238130-65238152 CCCTTTTCCTGCCCTGGGCAGCC No data
Right 1150447462 17:65238156-65238178 CAGGAATTTCACCTGATGGAGGG No data
1150447454_1150447462 -4 Left 1150447454 17:65238137-65238159 CCTGCCCTGGGCAGCCCTTCAGG No data
Right 1150447462 17:65238156-65238178 CAGGAATTTCACCTGATGGAGGG No data
1150447456_1150447462 -8 Left 1150447456 17:65238141-65238163 CCCTGGGCAGCCCTTCAGGAATT No data
Right 1150447462 17:65238156-65238178 CAGGAATTTCACCTGATGGAGGG No data
1150447457_1150447462 -9 Left 1150447457 17:65238142-65238164 CCTGGGCAGCCCTTCAGGAATTT No data
Right 1150447462 17:65238156-65238178 CAGGAATTTCACCTGATGGAGGG No data
1150447453_1150447462 2 Left 1150447453 17:65238131-65238153 CCTTTTCCTGCCCTGGGCAGCCC No data
Right 1150447462 17:65238156-65238178 CAGGAATTTCACCTGATGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150447462 Original CRISPR CAGGAATTTCACCTGATGGA GGG Intergenic