ID: 1150447464

View in Genome Browser
Species Human (GRCh38)
Location 17:65238164-65238186
Sequence TCACCTGATGGAGGGGTCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150447457_1150447464 -1 Left 1150447457 17:65238142-65238164 CCTGGGCAGCCCTTCAGGAATTT No data
Right 1150447464 17:65238164-65238186 TCACCTGATGGAGGGGTCTTAGG No data
1150447453_1150447464 10 Left 1150447453 17:65238131-65238153 CCTTTTCCTGCCCTGGGCAGCCC No data
Right 1150447464 17:65238164-65238186 TCACCTGATGGAGGGGTCTTAGG No data
1150447456_1150447464 0 Left 1150447456 17:65238141-65238163 CCCTGGGCAGCCCTTCAGGAATT No data
Right 1150447464 17:65238164-65238186 TCACCTGATGGAGGGGTCTTAGG No data
1150447452_1150447464 11 Left 1150447452 17:65238130-65238152 CCCTTTTCCTGCCCTGGGCAGCC No data
Right 1150447464 17:65238164-65238186 TCACCTGATGGAGGGGTCTTAGG No data
1150447454_1150447464 4 Left 1150447454 17:65238137-65238159 CCTGCCCTGGGCAGCCCTTCAGG No data
Right 1150447464 17:65238164-65238186 TCACCTGATGGAGGGGTCTTAGG No data
1150447458_1150447464 -10 Left 1150447458 17:65238151-65238173 CCCTTCAGGAATTTCACCTGATG No data
Right 1150447464 17:65238164-65238186 TCACCTGATGGAGGGGTCTTAGG No data
1150447451_1150447464 12 Left 1150447451 17:65238129-65238151 CCCCTTTTCCTGCCCTGGGCAGC No data
Right 1150447464 17:65238164-65238186 TCACCTGATGGAGGGGTCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150447464 Original CRISPR TCACCTGATGGAGGGGTCTT AGG Intergenic