ID: 1150447467

View in Genome Browser
Species Human (GRCh38)
Location 17:65238185-65238207
Sequence GGTCTGGTTTTCCAAGCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150447457_1150447467 20 Left 1150447457 17:65238142-65238164 CCTGGGCAGCCCTTCAGGAATTT No data
Right 1150447467 17:65238185-65238207 GGTCTGGTTTTCCAAGCCTTTGG No data
1150447465_1150447467 -5 Left 1150447465 17:65238167-65238189 CCTGATGGAGGGGTCTTAGGTCT No data
Right 1150447467 17:65238185-65238207 GGTCTGGTTTTCCAAGCCTTTGG No data
1150447456_1150447467 21 Left 1150447456 17:65238141-65238163 CCCTGGGCAGCCCTTCAGGAATT No data
Right 1150447467 17:65238185-65238207 GGTCTGGTTTTCCAAGCCTTTGG No data
1150447459_1150447467 10 Left 1150447459 17:65238152-65238174 CCTTCAGGAATTTCACCTGATGG No data
Right 1150447467 17:65238185-65238207 GGTCTGGTTTTCCAAGCCTTTGG No data
1150447458_1150447467 11 Left 1150447458 17:65238151-65238173 CCCTTCAGGAATTTCACCTGATG No data
Right 1150447467 17:65238185-65238207 GGTCTGGTTTTCCAAGCCTTTGG No data
1150447454_1150447467 25 Left 1150447454 17:65238137-65238159 CCTGCCCTGGGCAGCCCTTCAGG No data
Right 1150447467 17:65238185-65238207 GGTCTGGTTTTCCAAGCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150447467 Original CRISPR GGTCTGGTTTTCCAAGCCTT TGG Intergenic