ID: 1150447492

View in Genome Browser
Species Human (GRCh38)
Location 17:65238511-65238533
Sequence CTGTTAAAATGGAGCTACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150447492_1150447499 23 Left 1150447492 17:65238511-65238533 CCATTGTAGCTCCATTTTAACAG No data
Right 1150447499 17:65238557-65238579 ATCTCCAAACTTGGAATTGTAGG No data
1150447492_1150447498 14 Left 1150447492 17:65238511-65238533 CCATTGTAGCTCCATTTTAACAG No data
Right 1150447498 17:65238548-65238570 AGAAAATGCATCTCCAAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150447492 Original CRISPR CTGTTAAAATGGAGCTACAA TGG (reversed) Intergenic
No off target data available for this crispr