ID: 1150453702

View in Genome Browser
Species Human (GRCh38)
Location 17:65290316-65290338
Sequence TACAATAAACACTCTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150453700_1150453702 1 Left 1150453700 17:65290292-65290314 CCTGATTAGCGCATAACTTTGCA No data
Right 1150453702 17:65290316-65290338 TACAATAAACACTCTGAGGAAGG No data
1150453699_1150453702 2 Left 1150453699 17:65290291-65290313 CCCTGATTAGCGCATAACTTTGC No data
Right 1150453702 17:65290316-65290338 TACAATAAACACTCTGAGGAAGG No data
1150453695_1150453702 9 Left 1150453695 17:65290284-65290306 CCCAACCCCCTGATTAGCGCATA No data
Right 1150453702 17:65290316-65290338 TACAATAAACACTCTGAGGAAGG No data
1150453698_1150453702 3 Left 1150453698 17:65290290-65290312 CCCCTGATTAGCGCATAACTTTG No data
Right 1150453702 17:65290316-65290338 TACAATAAACACTCTGAGGAAGG No data
1150453694_1150453702 14 Left 1150453694 17:65290279-65290301 CCTAGCCCAACCCCCTGATTAGC No data
Right 1150453702 17:65290316-65290338 TACAATAAACACTCTGAGGAAGG No data
1150453697_1150453702 4 Left 1150453697 17:65290289-65290311 CCCCCTGATTAGCGCATAACTTT No data
Right 1150453702 17:65290316-65290338 TACAATAAACACTCTGAGGAAGG No data
1150453696_1150453702 8 Left 1150453696 17:65290285-65290307 CCAACCCCCTGATTAGCGCATAA No data
Right 1150453702 17:65290316-65290338 TACAATAAACACTCTGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150453702 Original CRISPR TACAATAAACACTCTGAGGA AGG Intergenic
No off target data available for this crispr