ID: 1150455369

View in Genome Browser
Species Human (GRCh38)
Location 17:65303007-65303029
Sequence GTGAATGAGCTTGAGGTTTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150455362_1150455369 30 Left 1150455362 17:65302954-65302976 CCGCAGGGCCAGGTTTTTCAAAG No data
Right 1150455369 17:65303007-65303029 GTGAATGAGCTTGAGGTTTAGGG No data
1150455363_1150455369 22 Left 1150455363 17:65302962-65302984 CCAGGTTTTTCAAAGTCTCTCGG No data
Right 1150455369 17:65303007-65303029 GTGAATGAGCTTGAGGTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150455369 Original CRISPR GTGAATGAGCTTGAGGTTTA GGG Intergenic
No off target data available for this crispr