ID: 1150456543

View in Genome Browser
Species Human (GRCh38)
Location 17:65310998-65311020
Sequence GGCTGCAGAGAAATGAGCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150456540_1150456543 -6 Left 1150456540 17:65310981-65311003 CCAAACTGGCCCAGTGTGGCTGC No data
Right 1150456543 17:65310998-65311020 GGCTGCAGAGAAATGAGCTAAGG No data
1150456539_1150456543 -5 Left 1150456539 17:65310980-65311002 CCCAAACTGGCCCAGTGTGGCTG No data
Right 1150456543 17:65310998-65311020 GGCTGCAGAGAAATGAGCTAAGG No data
1150456538_1150456543 -4 Left 1150456538 17:65310979-65311001 CCCCAAACTGGCCCAGTGTGGCT No data
Right 1150456543 17:65310998-65311020 GGCTGCAGAGAAATGAGCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150456543 Original CRISPR GGCTGCAGAGAAATGAGCTA AGG Intergenic
No off target data available for this crispr