ID: 1150465383

View in Genome Browser
Species Human (GRCh38)
Location 17:65388317-65388339
Sequence TAAGAAGCTTGCACAAAATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150465383_1150465392 29 Left 1150465383 17:65388317-65388339 CCCAATTTTGTGCAAGCTTCTTA No data
Right 1150465392 17:65388369-65388391 CAGCTGGGAATTCGAAGGCAGGG No data
1150465383_1150465389 14 Left 1150465383 17:65388317-65388339 CCCAATTTTGTGCAAGCTTCTTA No data
Right 1150465389 17:65388354-65388376 CTATAAAAATGAGAGCAGCTGGG No data
1150465383_1150465390 24 Left 1150465383 17:65388317-65388339 CCCAATTTTGTGCAAGCTTCTTA No data
Right 1150465390 17:65388364-65388386 GAGAGCAGCTGGGAATTCGAAGG No data
1150465383_1150465388 13 Left 1150465383 17:65388317-65388339 CCCAATTTTGTGCAAGCTTCTTA No data
Right 1150465388 17:65388353-65388375 CCTATAAAAATGAGAGCAGCTGG No data
1150465383_1150465391 28 Left 1150465383 17:65388317-65388339 CCCAATTTTGTGCAAGCTTCTTA No data
Right 1150465391 17:65388368-65388390 GCAGCTGGGAATTCGAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150465383 Original CRISPR TAAGAAGCTTGCACAAAATT GGG (reversed) Intergenic
No off target data available for this crispr