ID: 1150465386

View in Genome Browser
Species Human (GRCh38)
Location 17:65388348-65388370
Sequence TGCTCTCATTTTTATAGGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150465386_1150465391 -3 Left 1150465386 17:65388348-65388370 CCTAGCCTATAAAAATGAGAGCA No data
Right 1150465391 17:65388368-65388390 GCAGCTGGGAATTCGAAGGCAGG No data
1150465386_1150465392 -2 Left 1150465386 17:65388348-65388370 CCTAGCCTATAAAAATGAGAGCA No data
Right 1150465392 17:65388369-65388391 CAGCTGGGAATTCGAAGGCAGGG No data
1150465386_1150465390 -7 Left 1150465386 17:65388348-65388370 CCTAGCCTATAAAAATGAGAGCA No data
Right 1150465390 17:65388364-65388386 GAGAGCAGCTGGGAATTCGAAGG No data
1150465386_1150465394 6 Left 1150465386 17:65388348-65388370 CCTAGCCTATAAAAATGAGAGCA No data
Right 1150465394 17:65388377-65388399 AATTCGAAGGCAGGGTGATAGGG No data
1150465386_1150465395 7 Left 1150465386 17:65388348-65388370 CCTAGCCTATAAAAATGAGAGCA No data
Right 1150465395 17:65388378-65388400 ATTCGAAGGCAGGGTGATAGGGG No data
1150465386_1150465396 21 Left 1150465386 17:65388348-65388370 CCTAGCCTATAAAAATGAGAGCA No data
Right 1150465396 17:65388392-65388414 TGATAGGGGAAACAATTTCATGG No data
1150465386_1150465393 5 Left 1150465386 17:65388348-65388370 CCTAGCCTATAAAAATGAGAGCA No data
Right 1150465393 17:65388376-65388398 GAATTCGAAGGCAGGGTGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150465386 Original CRISPR TGCTCTCATTTTTATAGGCT AGG (reversed) Intergenic
No off target data available for this crispr