ID: 1150465391

View in Genome Browser
Species Human (GRCh38)
Location 17:65388368-65388390
Sequence GCAGCTGGGAATTCGAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150465387_1150465391 -8 Left 1150465387 17:65388353-65388375 CCTATAAAAATGAGAGCAGCTGG No data
Right 1150465391 17:65388368-65388390 GCAGCTGGGAATTCGAAGGCAGG No data
1150465386_1150465391 -3 Left 1150465386 17:65388348-65388370 CCTAGCCTATAAAAATGAGAGCA No data
Right 1150465391 17:65388368-65388390 GCAGCTGGGAATTCGAAGGCAGG No data
1150465384_1150465391 27 Left 1150465384 17:65388318-65388340 CCAATTTTGTGCAAGCTTCTTAT No data
Right 1150465391 17:65388368-65388390 GCAGCTGGGAATTCGAAGGCAGG No data
1150465385_1150465391 4 Left 1150465385 17:65388341-65388363 CCTTCAACCTAGCCTATAAAAAT No data
Right 1150465391 17:65388368-65388390 GCAGCTGGGAATTCGAAGGCAGG No data
1150465383_1150465391 28 Left 1150465383 17:65388317-65388339 CCCAATTTTGTGCAAGCTTCTTA No data
Right 1150465391 17:65388368-65388390 GCAGCTGGGAATTCGAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150465391 Original CRISPR GCAGCTGGGAATTCGAAGGC AGG Intergenic
No off target data available for this crispr