ID: 1150465395

View in Genome Browser
Species Human (GRCh38)
Location 17:65388378-65388400
Sequence ATTCGAAGGCAGGGTGATAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150465385_1150465395 14 Left 1150465385 17:65388341-65388363 CCTTCAACCTAGCCTATAAAAAT No data
Right 1150465395 17:65388378-65388400 ATTCGAAGGCAGGGTGATAGGGG No data
1150465386_1150465395 7 Left 1150465386 17:65388348-65388370 CCTAGCCTATAAAAATGAGAGCA No data
Right 1150465395 17:65388378-65388400 ATTCGAAGGCAGGGTGATAGGGG No data
1150465387_1150465395 2 Left 1150465387 17:65388353-65388375 CCTATAAAAATGAGAGCAGCTGG No data
Right 1150465395 17:65388378-65388400 ATTCGAAGGCAGGGTGATAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150465395 Original CRISPR ATTCGAAGGCAGGGTGATAG GGG Intergenic
No off target data available for this crispr