ID: 1150465408

View in Genome Browser
Species Human (GRCh38)
Location 17:65388490-65388512
Sequence CTGTGTGAACAGAAGGATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150465408_1150465419 22 Left 1150465408 17:65388490-65388512 CCACTATCCTTCTGTTCACACAG No data
Right 1150465419 17:65388535-65388557 GAGGGGGATTCATGTTCCTTTGG No data
1150465408_1150465415 3 Left 1150465408 17:65388490-65388512 CCACTATCCTTCTGTTCACACAG No data
Right 1150465415 17:65388516-65388538 CTATGGGACACTTAATCTGGAGG No data
1150465408_1150465418 6 Left 1150465408 17:65388490-65388512 CCACTATCCTTCTGTTCACACAG No data
Right 1150465418 17:65388519-65388541 TGGGACACTTAATCTGGAGGGGG No data
1150465408_1150465413 0 Left 1150465408 17:65388490-65388512 CCACTATCCTTCTGTTCACACAG No data
Right 1150465413 17:65388513-65388535 GTCCTATGGGACACTTAATCTGG No data
1150465408_1150465416 4 Left 1150465408 17:65388490-65388512 CCACTATCCTTCTGTTCACACAG No data
Right 1150465416 17:65388517-65388539 TATGGGACACTTAATCTGGAGGG No data
1150465408_1150465417 5 Left 1150465408 17:65388490-65388512 CCACTATCCTTCTGTTCACACAG No data
Right 1150465417 17:65388518-65388540 ATGGGACACTTAATCTGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150465408 Original CRISPR CTGTGTGAACAGAAGGATAG TGG (reversed) Intergenic
No off target data available for this crispr