ID: 1150470162

View in Genome Browser
Species Human (GRCh38)
Location 17:65430604-65430626
Sequence GCATCCTTTGGAAGATGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150470159_1150470162 -8 Left 1150470159 17:65430589-65430611 CCACCTACTTACTGAGCATCCTT No data
Right 1150470162 17:65430604-65430626 GCATCCTTTGGAAGATGCCCAGG No data
1150470158_1150470162 -5 Left 1150470158 17:65430586-65430608 CCGCCACCTACTTACTGAGCATC No data
Right 1150470162 17:65430604-65430626 GCATCCTTTGGAAGATGCCCAGG No data
1150470156_1150470162 10 Left 1150470156 17:65430571-65430593 CCTGCAATATTTCTCCCGCCACC No data
Right 1150470162 17:65430604-65430626 GCATCCTTTGGAAGATGCCCAGG No data
1150470157_1150470162 -4 Left 1150470157 17:65430585-65430607 CCCGCCACCTACTTACTGAGCAT No data
Right 1150470162 17:65430604-65430626 GCATCCTTTGGAAGATGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150470162 Original CRISPR GCATCCTTTGGAAGATGCCC AGG Intergenic