ID: 1150471441

View in Genome Browser
Species Human (GRCh38)
Location 17:65440861-65440883
Sequence TACTACCGAGTGTCTAGGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150471441_1150471443 16 Left 1150471441 17:65440861-65440883 CCTAACCTAGACACTCGGTAGTA No data
Right 1150471443 17:65440900-65440922 GTATTAGTTACCCATGTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150471441 Original CRISPR TACTACCGAGTGTCTAGGTT AGG (reversed) Intergenic
No off target data available for this crispr