ID: 1150473110

View in Genome Browser
Species Human (GRCh38)
Location 17:65454178-65454200
Sequence CCTCATGTGGGGAAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150473110_1150473118 2 Left 1150473110 17:65454178-65454200 CCCTCCACCTTCCCCACATGAGG No data
Right 1150473118 17:65454203-65454225 ACAGCGTTCCTTCCCTCCAGAGG No data
1150473110_1150473122 16 Left 1150473110 17:65454178-65454200 CCCTCCACCTTCCCCACATGAGG No data
Right 1150473122 17:65454217-65454239 CTCCAGAGGATACAGCAACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150473110 Original CRISPR CCTCATGTGGGGAAGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr