ID: 1150474354

View in Genome Browser
Species Human (GRCh38)
Location 17:65463381-65463403
Sequence CAGTGTGCTCAGAGGCTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150474354_1150474360 27 Left 1150474354 17:65463381-65463403 CCAGCCAGCCTCTGAGCACACTG No data
Right 1150474360 17:65463431-65463453 CTCTAACCCAGTGAGATAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150474354 Original CRISPR CAGTGTGCTCAGAGGCTGGC TGG (reversed) Intergenic
No off target data available for this crispr