ID: 1150474748

View in Genome Browser
Species Human (GRCh38)
Location 17:65466459-65466481
Sequence ATAAAGTGTCTGGCAAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150474743_1150474748 30 Left 1150474743 17:65466406-65466428 CCATCTCAAGGGTTTTCCATGAA No data
Right 1150474748 17:65466459-65466481 ATAAAGTGTCTGGCAAAAGAAGG No data
1150474746_1150474748 -6 Left 1150474746 17:65466442-65466464 CCAATGTGATAACTTATATAAAG No data
Right 1150474748 17:65466459-65466481 ATAAAGTGTCTGGCAAAAGAAGG No data
1150474745_1150474748 14 Left 1150474745 17:65466422-65466444 CCATGAAGGCTAAGTTTTAACCA No data
Right 1150474748 17:65466459-65466481 ATAAAGTGTCTGGCAAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150474748 Original CRISPR ATAAAGTGTCTGGCAAAAGA AGG Intergenic
No off target data available for this crispr