ID: 1150478794

View in Genome Browser
Species Human (GRCh38)
Location 17:65493657-65493679
Sequence CACTTCTAGCTCTATGAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150478785_1150478794 29 Left 1150478785 17:65493605-65493627 CCCCATTGATAGCTATCAGTGGG No data
Right 1150478794 17:65493657-65493679 CACTTCTAGCTCTATGAACTTGG No data
1150478788_1150478794 27 Left 1150478788 17:65493607-65493629 CCATTGATAGCTATCAGTGGGAG No data
Right 1150478794 17:65493657-65493679 CACTTCTAGCTCTATGAACTTGG No data
1150478791_1150478794 -10 Left 1150478791 17:65493644-65493666 CCCGCATAACTACCACTTCTAGC No data
Right 1150478794 17:65493657-65493679 CACTTCTAGCTCTATGAACTTGG No data
1150478787_1150478794 28 Left 1150478787 17:65493606-65493628 CCCATTGATAGCTATCAGTGGGA No data
Right 1150478794 17:65493657-65493679 CACTTCTAGCTCTATGAACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150478794 Original CRISPR CACTTCTAGCTCTATGAACT TGG Intergenic
No off target data available for this crispr