ID: 1150479545

View in Genome Browser
Species Human (GRCh38)
Location 17:65498870-65498892
Sequence TCTGCTTTCTGTTCCTCGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150479545_1150479547 6 Left 1150479545 17:65498870-65498892 CCAGGCGAGGAACAGAAAGCAGA No data
Right 1150479547 17:65498899-65498921 CTGGCTTCTTTTTGTGATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150479545 Original CRISPR TCTGCTTTCTGTTCCTCGCC TGG (reversed) Intergenic
No off target data available for this crispr