ID: 1150479546

View in Genome Browser
Species Human (GRCh38)
Location 17:65498880-65498902
Sequence AACAGAAAGCAGAAAAGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150479542_1150479546 0 Left 1150479542 17:65498857-65498879 CCAGAGCCTCTCTCCAGGCGAGG No data
Right 1150479546 17:65498880-65498902 AACAGAAAGCAGAAAAGAACTGG No data
1150479544_1150479546 -6 Left 1150479544 17:65498863-65498885 CCTCTCTCCAGGCGAGGAACAGA No data
Right 1150479546 17:65498880-65498902 AACAGAAAGCAGAAAAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150479546 Original CRISPR AACAGAAAGCAGAAAAGAAC TGG Intergenic
No off target data available for this crispr