ID: 1150483439

View in Genome Browser
Species Human (GRCh38)
Location 17:65528102-65528124
Sequence CCCAGAATGGGGAGGGTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150483432_1150483439 -8 Left 1150483432 17:65528087-65528109 CCTTGTTGATCAGCTCCCAGAAT No data
Right 1150483439 17:65528102-65528124 CCCAGAATGGGGAGGGTGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150483439 Original CRISPR CCCAGAATGGGGAGGGTGCC TGG Intergenic
No off target data available for this crispr