ID: 1150484790

View in Genome Browser
Species Human (GRCh38)
Location 17:65536367-65536389
Sequence CTCCAGCTGAGCCAGCGTGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 122}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150484784_1150484790 25 Left 1150484784 17:65536319-65536341 CCGCTGCTTTGGGGGCTTCGACA 0: 1
1: 0
2: 0
3: 6
4: 120
Right 1150484790 17:65536367-65536389 CTCCAGCTGAGCCAGCGTGTTGG 0: 1
1: 0
2: 1
3: 16
4: 122
1150484787_1150484790 -8 Left 1150484787 17:65536352-65536374 CCTGCGACAGGCCTCCTCCAGCT 0: 1
1: 0
2: 1
3: 20
4: 211
Right 1150484790 17:65536367-65536389 CTCCAGCTGAGCCAGCGTGTTGG 0: 1
1: 0
2: 1
3: 16
4: 122
1150484786_1150484790 2 Left 1150484786 17:65536342-65536364 CCTCAGCTAGCCTGCGACAGGCC 0: 1
1: 0
2: 2
3: 8
4: 146
Right 1150484790 17:65536367-65536389 CTCCAGCTGAGCCAGCGTGTTGG 0: 1
1: 0
2: 1
3: 16
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150484790 Original CRISPR CTCCAGCTGAGCCAGCGTGT TGG Exonic
900559233 1:3295467-3295489 CTCCAGGAGCACCAGCGTGTGGG + Intronic
901088775 1:6627937-6627959 GTCCAGCTGAGACAGCGAGAGGG - Intronic
901146908 1:7071022-7071044 CTCATGCTCAGCCAGCCTGTGGG - Intronic
902511810 1:16970709-16970731 CTCCAGCTCAGCCCCCGTGAGGG - Exonic
902863279 1:19260893-19260915 CTAAAGCTGAGACAGCGTGGAGG - Intergenic
911118454 1:94271032-94271054 CTCCAGCTCAGCCAACATCTTGG - Intronic
918005735 1:180540600-180540622 CTCCAGGTGAGTCAGAGTGAGGG - Intergenic
919825554 1:201500677-201500699 CTCCAGGTGACCCTGCCTGTGGG + Intronic
1064066039 10:12182266-12182288 CTCCAGCTGGGGCATCATGTTGG + Intronic
1067795972 10:49322590-49322612 CTCCAGCATCGGCAGCGTGTTGG + Exonic
1068079366 10:52300600-52300622 ATCCAGCTGAGCCAGCGCTCAGG - Intergenic
1068632118 10:59308841-59308863 CTCGTGCTGAGTCAGCCTGTAGG + Intronic
1069535319 10:69248624-69248646 CTCCAGCTCAGCCCGCATCTTGG - Exonic
1069783186 10:70969595-70969617 CTCTAGCTGAGCCAGTGTAGTGG + Intergenic
1071204928 10:83263500-83263522 CTCCAGCAGAGCCACAGAGTGGG + Intergenic
1072795486 10:98351662-98351684 CTCCAGCAGAGCCAGGGTGAAGG - Intergenic
1076793959 10:132789897-132789919 CTCAAGCTGAGACCGCGTGGAGG - Intergenic
1076995669 11:296437-296459 CTGCAGCTGAGGGAGCCTGTAGG - Intergenic
1082802588 11:57425740-57425762 CTCCACCTCAGACAGCTTGTCGG + Intronic
1083903490 11:65655144-65655166 CCCCATCTGACCCAGCCTGTAGG + Intronic
1084004971 11:66317813-66317835 TTCCAGCTGGGCCAGCGTGTGGG + Intergenic
1084641879 11:70431046-70431068 CTCCAGCTCAGCCTTGGTGTGGG + Intronic
1085143462 11:74171055-74171077 CTCCAGCTGCGCAAGCGCATAGG + Intronic
1085781557 11:79413536-79413558 CTCCAGCTGAGGCAGCTGTTAGG - Intronic
1089209504 11:116790815-116790837 CTCCATCAGATCCATCGTGTAGG + Exonic
1089391463 11:118104781-118104803 CTCTCGCTGAGACAGCCTGTAGG + Exonic
1089587196 11:119517733-119517755 CTCCAGCTGACCCAGGGTCAGGG - Intergenic
1091347485 11:134864866-134864888 CTCCCGCTCAGCCAGCCTGGGGG - Intergenic
1101211951 12:102543577-102543599 CTAGTGCTGAGCCATCGTGTGGG + Intergenic
1102007909 12:109600233-109600255 CTCCAGGTCAGCAAGCGTGGTGG + Intergenic
1108245108 13:48506159-48506181 CTCCAGCTCTGCCTGCATGTTGG - Intronic
1109108581 13:58287285-58287307 TTCCAGCTGAACCAGCATGTAGG - Intergenic
1113640123 13:111951411-111951433 CTCCTGCTGAGCCAGCAGCTAGG + Intergenic
1114319530 14:21535892-21535914 GTACATCTGAGCCAGGGTGTGGG - Intronic
1122816920 14:104318578-104318600 CCCCAGCTGAGGCTGGGTGTGGG - Intergenic
1125598579 15:40903085-40903107 CTCCAGCCGGGCCTGCTTGTAGG - Exonic
1125603913 15:40929513-40929535 CTGCAGCGGAGCCAGCGAGAAGG + Exonic
1125731286 15:41894028-41894050 CTCCCCTTGAGCCAGCGTGCTGG + Exonic
1128594033 15:68928903-68928925 CTCCACCTGCGCCTGGGTGTGGG - Intronic
1129462674 15:75707754-75707776 CTCCAGCTGAGCCGGCCTGGAGG - Intronic
1129488953 15:75904399-75904421 CTGCTGCTGCGCCAGCGGGTGGG + Intronic
1129738165 15:77977063-77977085 CTTCAGCTGAGTCAGCATGTGGG + Intergenic
1129847907 15:78776530-78776552 CTTCAGCTGAGTCAGCATGTGGG - Intronic
1130254004 15:82317386-82317408 CTTCAGCTGAGTCAGCACGTGGG + Intergenic
1131343534 15:91625367-91625389 CTCCAGCTGGCCAAGCATGTTGG - Intergenic
1134269617 16:12722351-12722373 CTCCAGCTGAGGCAGGCTGCAGG + Intronic
1134388241 16:13794168-13794190 CTCCAGCCAAGCCAGCCTCTTGG + Intergenic
1137665423 16:50246453-50246475 CGCCAGCTGGGGCAGCGTCTGGG - Intronic
1138555953 16:57771315-57771337 CTCCACCTCAGCCAGCCGGTCGG + Exonic
1139395212 16:66633347-66633369 CTCCAGCAGAGCCAGCCTGATGG - Intronic
1139545134 16:67646452-67646474 CTCCAGCCGAGCCAGCATGGAGG - Exonic
1140314936 16:73887208-73887230 CTCTAGCTGTGACAGCGTGTTGG + Intergenic
1142172730 16:88631202-88631224 CTCCCGCCGAGACAGCGTGCTGG - Exonic
1142504269 17:352852-352874 CTCCAGCTGGGCCTGCCTGGTGG - Intronic
1143544322 17:7587606-7587628 CCCCATCTGAGCCAGCCTGCTGG + Exonic
1144848690 17:18233279-18233301 CCCCAGCTGAGTGAGAGTGTGGG + Intronic
1145935929 17:28714827-28714849 CTCCAGCTCAGCCAGCACATTGG + Intronic
1149998559 17:61417621-61417643 TTCCATCTGAGCCAGAGTGGGGG + Intergenic
1150484790 17:65536367-65536389 CTCCAGCTGAGCCAGCGTGTTGG + Exonic
1151821286 17:76498254-76498276 ATCCAGCTGAGCCAGGCTGGGGG - Intronic
1160932776 19:1578460-1578482 CTCCACGTGCGCCAGCATGTCGG + Exonic
1161014505 19:1977095-1977117 ATCCAGCTGGGTCACCGTGTTGG - Intronic
1161237379 19:3204688-3204710 CTCCAGGTGGGACAGCGTGAAGG - Exonic
1161294664 19:3513590-3513612 TTCCAGCTGTGCCAGCTGGTAGG + Intronic
1163362369 19:16855256-16855278 CTCCGGCTGAGGCAGGGTTTTGG - Intronic
1164609769 19:29624120-29624142 CTGCAGCTTAACCAGGGTGTCGG + Intergenic
1165386161 19:35511780-35511802 CTCCACCTGAGCCAGATGGTGGG + Exonic
1165420904 19:35721407-35721429 CTCCAGCTGAGCCTGAGCCTCGG + Exonic
1165445128 19:35852567-35852589 CTCCAGCTGGGCCAGCTGGGAGG - Intronic
1166528373 19:43527125-43527147 CGGCAGCTGAGCCAGCGCGGCGG - Exonic
1166992034 19:46698343-46698365 CTCCTTCTGGGCCAGCGTGGTGG - Intronic
925196471 2:1930038-1930060 CTCCAGCTGAGGGAGCATGCAGG - Intronic
926049759 2:9737374-9737396 CTTCAGCTGAGCCAGTGTATTGG + Intergenic
926198241 2:10776367-10776389 CTCCGGCTGAGCCTGCGGGGAGG + Intronic
929639216 2:43559452-43559474 CTGCAGCTGAGCCATGGTCTAGG - Intronic
930007364 2:46908956-46908978 CTGCAGCTGAGCCAGCGGCAAGG - Intronic
932783201 2:74576553-74576575 CGTCAGCTGTGCCAGCGAGTAGG + Exonic
935066761 2:99655498-99655520 CTTCAGCTGAGCCAGGATCTAGG - Intronic
936488304 2:112946400-112946422 CTCCAGCTTAGCCCGTGTTTAGG - Intergenic
937236017 2:120432358-120432380 CTGCAGCAGAGCAAGCCTGTGGG - Intergenic
937770676 2:125717015-125717037 CTACAGTTGAGCAAGCCTGTTGG - Intergenic
938381291 2:130837696-130837718 CCCCAGGTGAGCCAGCGGGAGGG + Intronic
947916800 2:233837893-233837915 CGCTAGCTGGGCCAGGGTGTGGG - Intronic
948356683 2:237383825-237383847 CTCCCGATGAGCCAGCGGGAAGG + Intronic
1172485948 20:35297983-35298005 CTCCCGCCCAGCCAGCGCGTTGG - Intergenic
1175044268 20:56089688-56089710 CTTCAGAGGAGCCAGCGAGTAGG - Intergenic
1175172964 20:57092798-57092820 CTCCAGCTGGGCCTGCGTGGAGG - Intergenic
1175862866 20:62159493-62159515 GTCCAGCTGAGCCAGGCAGTGGG - Intronic
1176080297 20:63269206-63269228 CTCCAGCATAGCCAGAGGGTCGG - Intronic
1176188642 20:63795783-63795805 CTCCAGCTGACCCAGGGAGGAGG - Intronic
1176259581 20:64172424-64172446 CTGGGGATGAGCCAGCGTGTGGG + Intronic
1178488398 21:33033061-33033083 CGGCAGCTGAGCCAGAGTCTGGG - Intergenic
1179979473 21:44888733-44888755 GTCCTGCTGCTCCAGCGTGTAGG + Exonic
1182288191 22:29260222-29260244 CTCCAGCTGCTGCAGCCTGTTGG + Exonic
1185186248 22:49402238-49402260 CTCCAGCAGGGCCAGTGTCTGGG + Intergenic
955769824 3:62375558-62375580 CTCCAGATGAGCAAGCCTCTTGG - Intergenic
961054586 3:123777499-123777521 CTCGAGCTGTGGCAGAGTGTGGG - Intronic
965672859 3:171164898-171164920 CTGCAGATGAGCCACCGTTTTGG + Intronic
966746276 3:183280169-183280191 CTCCTGGAGAGCCTGCGTGTTGG - Intronic
966931333 3:184677676-184677698 CTCCAGCTGAGCCAGCTCCAGGG + Intronic
967685313 3:192410002-192410024 CTCCAGCTGAGCCAGCCGGAGGG - Intronic
969292778 4:6251518-6251540 CTACAGTTGAGCCAGCCTGCAGG + Intergenic
969909414 4:10429448-10429470 CTCCAGCTGTGCCAGCAAATGGG + Intergenic
970156631 4:13148909-13148931 CTCCACCTGAGCCAGCTCATAGG + Intergenic
971377647 4:26068053-26068075 CTCAAGGTGAGCGAGAGTGTCGG + Intergenic
975322624 4:73025562-73025584 TTCCAGCTGAGAAAGAGTGTAGG + Intergenic
978885162 4:113760574-113760596 CTCCTGGTTAGCCGGCGTGTCGG - Intronic
980180114 4:129392302-129392324 CTGCAGCTGTGCCTGGGTGTTGG - Intergenic
986740653 5:10702420-10702442 ATCCAGCTCAGCCAGATTGTCGG - Intronic
987066051 5:14290858-14290880 CTCCAGCCGAGACAGCATGTGGG - Exonic
989106303 5:37866492-37866514 CTGGAGCTGAGCTAGCTTGTTGG + Intergenic
997749050 5:136327120-136327142 ATAAAACTGAGCCAGCGTGTTGG + Intronic
1003363928 6:5454829-5454851 TTCCAGCTGAGCAAGCCTTTCGG + Intronic
1003565351 6:7217450-7217472 TCCCAGCTGAGCCAGCGTCCAGG + Intronic
1005916164 6:30353397-30353419 CTCCAACTGAGCCTGAATGTTGG - Intergenic
1006546241 6:34784369-34784391 CTCCAGGTGTTCCAGAGTGTTGG - Intergenic
1006609932 6:35288358-35288380 TTCCAGCTGAGCTACTGTGTGGG - Intronic
1007230376 6:40343926-40343948 GTCCAGCTGGGTCAGCCTGTGGG - Intergenic
1007281937 6:40719352-40719374 CTCCATCTGAGCCACCCTATGGG - Intergenic
1007629162 6:43263216-43263238 CCCCAGCTGAGCCAGGGCGATGG + Exonic
1011823361 6:91278192-91278214 CTCCAGCTCAGGCAGAGTGATGG - Intergenic
1017655009 6:156619167-156619189 CTTCAGCTGAGCCCCCGTTTGGG - Intergenic
1021608779 7:22435932-22435954 CTCAAGCTGAGCCACTGCGTGGG + Intronic
1033728476 7:144147367-144147389 CTCCAGCAGACCCAGGGTTTAGG + Intergenic
1034211277 7:149365304-149365326 CTCCAGCTGGGCCAACCTGCTGG - Intergenic
1034970856 7:155418282-155418304 CTGCAGCTGAGGCAGCCTGAAGG + Intergenic
1035062994 7:156082828-156082850 CTCCTGCTGCGCCAGGGAGTGGG - Intergenic
1036393709 8:8348328-8348350 CTCTAGCTTAGCCACCATGTTGG + Intronic
1037575374 8:20197606-20197628 CACCTGCTTAGCCAGCGGGTAGG + Intronic
1043879661 8:85528017-85528039 CTCCTGCTGCTCCAGTGTGTAGG + Intergenic
1044279484 8:90339210-90339232 CTCCAGCTGAGCCTCAGTATGGG - Intergenic
1060535015 9:124378923-124378945 GTCCAGCTAAGCTAGCCTGTGGG + Intronic
1062302589 9:135883493-135883515 CACCAGCGGAGACAGCATGTGGG + Intronic
1062312386 9:135945880-135945902 CTTCAGCTGAACCAGTGCGTGGG - Exonic
1062525706 9:136977319-136977341 CCCCAGCTGAGGCAGCGTGGGGG - Intergenic
1190247389 X:48699654-48699676 GTCCAGGTGAGCCAGGGTGGTGG + Intronic
1196739615 X:119013139-119013161 CTCCATCAGAGCCAGCGGGATGG + Exonic
1202267568 Y:23036962-23036984 CTCTACCTGAGCCAGCGTCTAGG + Intergenic
1202420560 Y:24670706-24670728 CTCTACCTGAGCCAGCGTCTAGG + Intergenic
1202450226 Y:24999376-24999398 CTCTACCTGAGCCAGCGTCTAGG - Intergenic