ID: 1150485121

View in Genome Browser
Species Human (GRCh38)
Location 17:65537876-65537898
Sequence CAGAAGGGCCAGAGGCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 727
Summary {0: 1, 1: 0, 2: 6, 3: 68, 4: 652}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150485111_1150485121 18 Left 1150485111 17:65537835-65537857 CCTGAAAGGGAAGACGTCAGAAG 0: 1
1: 0
2: 1
3: 16
4: 157
Right 1150485121 17:65537876-65537898 CAGAAGGGCCAGAGGCCCTGGGG 0: 1
1: 0
2: 6
3: 68
4: 652

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150485121 Original CRISPR CAGAAGGGCCAGAGGCCCTG GGG Intronic
900557206 1:3286622-3286644 CATAAGGGCCTGAGGGCCTGGGG + Intronic
900939156 1:5786740-5786762 CAGCAGGTGCAAAGGCCCTGAGG + Intergenic
901204768 1:7487899-7487921 CAGCAGGGCCTGGGGTCCTGAGG - Intronic
901252939 1:7795569-7795591 CAGCAGGCGCAGAGGCCCTGGGG + Intronic
901432369 1:9224867-9224889 CAGCAGGTGCAAAGGCCCTGAGG - Intergenic
901548020 1:9973789-9973811 CAGAAGGGGCAGATTACCTGAGG + Intronic
901661374 1:10799875-10799897 CAGCAGGTGCAGAGGCCCTGAGG - Intergenic
901690725 1:10971477-10971499 CAGTATGTGCAGAGGCCCTGAGG - Intronic
901705759 1:11071764-11071786 CAGCGAGCCCAGAGGCCCTGGGG - Intronic
902635557 1:17732928-17732950 CAGAGGGACCTGAGGCCATGAGG + Intergenic
902707943 1:18219322-18219344 CAGCAAGGGCAAAGGCCCTGAGG + Intronic
903008663 1:20315214-20315236 CAGCAGGGACAAAGGCCCTGGGG + Intronic
903133970 1:21297194-21297216 CTCAACTGCCAGAGGCCCTGGGG + Intronic
903386148 1:22928225-22928247 CAGCAGGAGCAAAGGCCCTGAGG + Intergenic
903849265 1:26296497-26296519 CAGCACGGCCCAAGGCCCTGAGG + Intronic
904304621 1:29580205-29580227 CAGCAGGGCCAGGAGACCTGAGG - Intergenic
904356400 1:29942867-29942889 CAGAATGTGCAAAGGCCCTGAGG + Intergenic
904396566 1:30226258-30226280 CAGAAGGGCAAGTAGCCTTGTGG - Intergenic
904459264 1:30665926-30665948 CAGAAGGGAAAGAGGGTCTGGGG - Intergenic
904799929 1:33085456-33085478 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
904947058 1:34207014-34207036 CAGAAAGTCCACAGGCCATGAGG + Intronic
904992110 1:34601465-34601487 CAGATGTTCCAGTGGCCCTGTGG + Intergenic
905206127 1:36343799-36343821 TAGGATGGGCAGAGGCCCTGAGG + Intronic
905406342 1:37735188-37735210 CTGAAGAACCAGAAGCCCTGCGG + Intronic
905421708 1:37850665-37850687 CAGAATGACCAGCGGCCTTGTGG + Intronic
905606564 1:39305801-39305823 CAGGAAGTCCAAAGGCCCTGAGG - Intronic
905625925 1:39490935-39490957 CAGCTGGGCCAGAAGCTCTGGGG - Intergenic
906527444 1:46503149-46503171 CAGCAAGGACAAAGGCCCTGAGG - Intergenic
906666377 1:47625001-47625023 CAGCATGTCCAAAGGCCCTGGGG - Intergenic
906723944 1:48030102-48030124 CAGGAGTGCTAGAGGCACTGGGG - Intergenic
906933951 1:50195629-50195651 CTGAATGGCCAGAAGCCCAGCGG + Exonic
907047290 1:51307029-51307051 CAGCACGTCCAAAGGCCCTGAGG + Intronic
907388188 1:54139460-54139482 AAGAGGGGCCAGGGGCCCAGGGG + Exonic
907400539 1:54222338-54222360 CAGCAGGAACAAAGGCCCTGGGG + Intronic
907671812 1:56481026-56481048 CAGAGTGTGCAGAGGCCCTGTGG + Intergenic
907832050 1:58073898-58073920 CAGAAGGCCCGGAACCCCTGGGG + Intronic
908260991 1:62339112-62339134 CAGTACGGCCAGTGGCCCGGGGG + Intergenic
908267992 1:62397192-62397214 AAGTGGGGCCACAGGCCCTGGGG + Intergenic
910001687 1:82349821-82349843 CAAAGGGGCTACAGGCCCTGAGG + Intergenic
910686033 1:89917556-89917578 CAGAATGTGCAAAGGCCCTGTGG - Intronic
913078928 1:115364114-115364136 CAAAAGGGACACAGGCCCTGGGG - Intergenic
914754250 1:150553922-150553944 CAGCAGGGCCAAGGGCCTTGGGG + Exonic
915242978 1:154537058-154537080 TAGTAGGTCCAGAGGCCCTAAGG - Intronic
915283589 1:154838961-154838983 CAGAAGGGCCAGTGCCACTCAGG + Intronic
915534868 1:156529256-156529278 CTCAACGGGCAGAGGCCCTGAGG - Intronic
915580859 1:156812464-156812486 CAGCAGGTGCAAAGGCCCTGAGG - Intronic
915589718 1:156863625-156863647 AAGAGGGGCCAGAGGCTATGGGG + Intronic
915729783 1:158045080-158045102 CAGCAGAGGCAGAGGTCCTGAGG + Intronic
915943975 1:160136502-160136524 CAGAAGGGGCACAGCCCCTCAGG - Intronic
918084562 1:181234825-181234847 CAGCAGGTGCAAAGGCCCTGAGG - Intergenic
918471719 1:184882158-184882180 GATAAGGGCCAGAAACCCTGAGG - Intronic
918576926 1:186072726-186072748 CAGCAAGGGCAAAGGCCCTGAGG + Intronic
919516576 1:198532765-198532787 CAGCAAGTGCAGAGGCCCTGAGG + Intronic
919821235 1:201473502-201473524 CAGCAGGTGCAAAGGCCCTGAGG - Intergenic
920377679 1:205518012-205518034 CAGCAGGGGCAAAGGTCCTGAGG - Intronic
922806845 1:228394691-228394713 CAGGAGGGCCCGAGTCACTGGGG + Exonic
922997382 1:229975234-229975256 CAGTAGGTGCAAAGGCCCTGTGG + Intergenic
923004472 1:230035815-230035837 CAGAAAGGCCAGAAGCAGTGGGG - Intergenic
923525494 1:234769444-234769466 CAGAAGGGCCAGCTGGCCTGGGG - Intergenic
923730807 1:236547750-236547772 AAGGAGGGCCGCAGGCCCTGGGG + Intronic
923838006 1:237635870-237635892 TAGCAGGTGCAGAGGCCCTGAGG - Intronic
924423795 1:243932710-243932732 CAAAAGGACCTGAGGTCCTGTGG - Intergenic
1063154859 10:3369561-3369583 GAGAAGGGACAGAGGCTCTATGG - Intergenic
1063218934 10:3948604-3948626 GAAAAGGACTAGAGGCCCTGGGG - Intergenic
1063404073 10:5775951-5775973 GAGAGGGGCCACAGTCCCTGCGG + Intronic
1063461303 10:6216415-6216437 AGGAAGGGCCAGTGGTCCTGTGG - Intronic
1063837804 10:10035529-10035551 TAGAATGGCAAGAGGCTCTGTGG + Intergenic
1063973106 10:11395321-11395343 TAGGAGGGCCAGAGGCAGTGAGG - Intergenic
1064691833 10:17926562-17926584 CAGCATGGGCAAAGGCCCTGGGG - Intergenic
1065434636 10:25694284-25694306 CACAAGGGCCCGAGGACATGAGG + Intergenic
1066460627 10:35609072-35609094 CAGAAGGGCGAGCTGGCCTGGGG + Intergenic
1067061381 10:43079683-43079705 CAGAAGGCCCCGGGGCCCAGGGG - Intronic
1067136263 10:43609543-43609565 CAGATGGGCCTGAGGCCCTCAGG - Intronic
1067470556 10:46534879-46534901 CAGGAGGGCCTGAGTCACTGTGG - Intergenic
1069717638 10:70531198-70531220 CAGCTTGGGCAGAGGCCCTGAGG + Intronic
1070331657 10:75421920-75421942 GAGAAGGGACAGAGGCCAGGAGG - Intergenic
1070494534 10:77009683-77009705 AAGAAAGGCCAGTGGCACTGGGG - Intronic
1070496583 10:77029759-77029781 CAGCAAGCACAGAGGCCCTGAGG + Intronic
1070975786 10:80604487-80604509 CAGGAGGGCCAGAGGCTGGGTGG + Intronic
1071479837 10:86056855-86056877 CAGATGGGCCCGAGGCCCTAGGG - Intronic
1072664721 10:97384862-97384884 CAGCCGGGACGGAGGCCCTGAGG + Intronic
1072664757 10:97384975-97384997 CAGCCTGGACAGAGGCCCTGAGG + Intronic
1072762139 10:98065465-98065487 GAGAAGGCCCAGAGGACCTGGGG - Intergenic
1074066335 10:110017990-110018012 GAGAAGGACCAGAAGCCCTAAGG - Intronic
1074765050 10:116694502-116694524 CAGAAGGTCAAGTGGCCATGTGG - Intronic
1075044649 10:119136899-119136921 CAGAACAGCTAGAGGTCCTGGGG + Exonic
1075648888 10:124114750-124114772 GAGATGGGGCAGAGGCCCTGGGG + Intergenic
1075999475 10:126904159-126904181 CAGGATGGCCACAGGGCCTGGGG - Intergenic
1076222199 10:128743252-128743274 CAGAGGGGCCAGAGGCAGGGTGG + Intergenic
1076319968 10:129570841-129570863 TATAAGGGCCTGAGGGCCTGGGG + Intronic
1076373330 10:129968327-129968349 GAGCAGGGCTAGAGGCCCGGAGG - Intergenic
1076497300 10:130905496-130905518 CAGTAGGGGCAGAGGCTCGGCGG - Intergenic
1076679202 10:132163040-132163062 CAGAAGGACCAGGGGCCCCACGG - Intronic
1076869521 10:133186491-133186513 CAGCACGGACAGGGGCCCTGGGG + Exonic
1077115001 11:880145-880167 CAAACGAGCCAGGGGCCCTGGGG + Intronic
1078453344 11:11456501-11456523 GAAAAGGGCCAGAGCACCTGGGG - Intronic
1078458804 11:11497076-11497098 CAGCAGGTGCAAAGGCCCTGAGG - Intronic
1079083071 11:17427535-17427557 GAGAATGGACAAAGGCCCTGAGG - Intronic
1079299368 11:19263946-19263968 CAGAAAGTGCAAAGGCCCTGAGG + Intergenic
1080166524 11:29243497-29243519 CAGAAGGGCCAGAAGGCAAGAGG - Intergenic
1081278055 11:41175212-41175234 CAGAAAGACCAGAAGCCTTGAGG - Intronic
1081540214 11:44029315-44029337 CAGCAAGGGCAAAGGCCCTGAGG - Intergenic
1081634813 11:44714076-44714098 CAGCAGGTGCAAAGGCCCTGGGG + Intergenic
1081691125 11:45079442-45079464 GAGAAGGGGCAGAGGACATGAGG - Intergenic
1081796043 11:45820650-45820672 CAGCAGGTGCAAAGGCCCTGGGG + Intergenic
1083180947 11:60984814-60984836 GAGCAGGGGCGGAGGCCCTGAGG + Intronic
1083587396 11:63870202-63870224 TAGAGGTGCCAGAGGCCCTAGGG + Intronic
1083853517 11:65380867-65380889 CAGGTGGGGCAGAGGCCCAGAGG + Intronic
1084213271 11:67633628-67633650 CAGTAGGTGCAAAGGCCCTGAGG - Intronic
1084219414 11:67668066-67668088 CAGAAGGGAGGGAGGCCCAGGGG - Intronic
1084368615 11:68721286-68721308 CAGCAGGTGCAAAGGCCCTGTGG - Intronic
1084561896 11:69910124-69910146 CAGAAGGGCCATGGCCCCTGGGG - Intergenic
1084571030 11:69959930-69959952 CAGCAGGCACAAAGGCCCTGTGG - Intergenic
1084671400 11:70608660-70608682 AAGCAGGGAGAGAGGCCCTGAGG - Intronic
1085282986 11:75342795-75342817 CAGCAGGAACAAAGGCCCTGAGG + Intronic
1085521042 11:77138990-77139012 CAGAAAGGGCTAAGGCCCTGTGG + Intronic
1086850076 11:91798716-91798738 CAGAGGGGGCAGAGGCAGTGGGG - Intergenic
1087626606 11:100603518-100603540 GAGAAGGGACAAAGCCCCTGGGG + Intergenic
1089496014 11:118909089-118909111 GAGAAGGGCCACAGGACCTGGGG + Intronic
1089559611 11:119337225-119337247 CAGAAGGGCCCAGGGCCCAGGGG + Exonic
1089729895 11:120512896-120512918 CAGACGGGCCAGAGGCGCCCGGG - Intronic
1090276599 11:125424464-125424486 TAGGAGGGCCAGAGACCCAGAGG - Intronic
1090561628 11:127938766-127938788 AAGCAGGGGCAGAGGGCCTGGGG - Intergenic
1091953741 12:4618357-4618379 CAGAGGGGCCAGATTCCCAGTGG + Intronic
1092762226 12:11820582-11820604 CAGCAAGTCCAAAGGCCCTGAGG + Intronic
1092771610 12:11902335-11902357 ATGAAGGGTCAGAGGCCCAGCGG + Intergenic
1093959894 12:25260676-25260698 CAGCAGGTGCAAAGGCCCTGAGG - Intergenic
1094492010 12:30966657-30966679 CAGAGGGACCAGAGGCCAAGGGG + Intronic
1094677879 12:32638815-32638837 CTGAAGGGACAGATGCCCTTGGG + Intronic
1095040224 12:37432948-37432970 CAGAAGGGGCAGATGCCCCAGGG + Intergenic
1095406106 12:41869179-41869201 GAGTAGGGGCAGATGCCCTGGGG + Intergenic
1095671515 12:44866055-44866077 CAGAAGGGCAAGAGACTCTAGGG - Intronic
1095821293 12:46481452-46481474 CAGCAAGGGCAAAGGCCCTGAGG + Intergenic
1095943395 12:47740403-47740425 CAGAAGACCCAGAGACCCTCAGG + Intronic
1096257517 12:50072423-50072445 CAGAGGGGCCAGGGGCCTGGGGG + Intronic
1096406639 12:51348585-51348607 CAGCAGGGCCAGATCACCTGAGG + Intergenic
1096487958 12:51996344-51996366 TAGAAGGGCCAGGAGCACTGGGG - Intronic
1096516402 12:52157968-52157990 TAGCAAGGCCAGAGGCCCAGAGG - Intergenic
1096606820 12:52772587-52772609 CAAAATGGCCTGAGGACCTGTGG + Intronic
1096977338 12:55707158-55707180 CAGGGGAGCCAGAGGCCCTGGGG + Intronic
1097148034 12:56955000-56955022 GAGGAGGGCCAGGGGCCGTGTGG - Exonic
1097176786 12:57147871-57147893 CAGGAGGGTCAGCAGCCCTGGGG - Intronic
1097981418 12:65741364-65741386 CAGCTGGGCCAGAGACCCCGAGG - Intergenic
1098134899 12:67391838-67391860 CAGAATGTGCAAAGGCCCTGAGG + Intergenic
1098232577 12:68387580-68387602 CAGCAAGTACAGAGGCCCTGAGG - Intergenic
1098249972 12:68559440-68559462 CAGCAAGGACAAAGGCCCTGAGG + Intergenic
1099240407 12:80131393-80131415 GAGGAGAGTCAGAGGCCCTGAGG + Intergenic
1100013857 12:89985205-89985227 CAGAAGGGGCAGAGTAACTGTGG - Intergenic
1100403190 12:94250091-94250113 CAGAGGGAGCAGAGGTCCTGAGG + Intronic
1101013047 12:100471185-100471207 CAGAAAGTACAGGGGCCCTGGGG + Intergenic
1101878473 12:108610562-108610584 CAGCAAGGGCAAAGGCCCTGAGG + Intergenic
1102016297 12:109650129-109650151 GAGATGGCACAGAGGCCCTGAGG + Intergenic
1102017506 12:109657412-109657434 CAGCAAGGACAAAGGCCCTGGGG + Intergenic
1102429138 12:112868018-112868040 GAGAAAGGCCAGAGGTCTTGGGG + Intronic
1102466133 12:113131779-113131801 CAGCAGGTGCAAAGGCCCTGAGG - Intronic
1102477455 12:113197876-113197898 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1102527683 12:113523688-113523710 CAGCAAGGGCAAAGGCCCTGAGG - Intergenic
1102587196 12:113931698-113931720 CAGCAGGTGCAAAGGCCCTGTGG - Intronic
1102625851 12:114234966-114234988 CAGAAGATGCAAAGGCCCTGAGG + Intergenic
1103584264 12:121939437-121939459 CAGAAGGGTCAGAGTCCTTCAGG + Intronic
1103776374 12:123369580-123369602 AAGTTGGGGCAGAGGCCCTGTGG + Intergenic
1103830524 12:123775587-123775609 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1103888639 12:124221874-124221896 CAGCAAGTGCAGAGGCCCTGAGG - Intronic
1103937557 12:124484614-124484636 CAGCAGGTGCAAAGGCCCTGGGG - Intronic
1104164709 12:126216529-126216551 CAGCAGGTCCTGAGGCCATGGGG + Intergenic
1104443452 12:128814132-128814154 CAGAATGGCGAGATGCACTGAGG - Intronic
1104623079 12:130332952-130332974 CACCAGGGTCAGAGGCTCTGGGG + Intergenic
1104955869 12:132465549-132465571 CAGGTGGCCGAGAGGCCCTGGGG - Intergenic
1105026638 12:132853465-132853487 CAGGAGCCCCACAGGCCCTGGGG - Exonic
1105447372 13:20469534-20469556 CAGAAAGGCCAGAGGCTGGGAGG + Intronic
1106020336 13:25908497-25908519 CGGAAGGACCTGAGGCCTTGTGG - Intronic
1106128087 13:26917191-26917213 CAGAAGGGCAAAAGGCACTATGG + Intergenic
1106717945 13:32410265-32410287 CAGAAGGATGACAGGCCCTGCGG - Intronic
1106764583 13:32901234-32901256 CAGAAAGTGCAAAGGCCCTGGGG - Intergenic
1106952649 13:34901748-34901770 CAGAAGGCCCAGATCCCCTCAGG - Intergenic
1107430063 13:40332468-40332490 CAGAAGTACCAGAGGCCTTGGGG + Intergenic
1108374176 13:49797917-49797939 CAGAAGGGCAACAGGCACTACGG - Intergenic
1108637637 13:52351545-52351567 CAGCATGTGCAGAGGCCCTGAGG + Intergenic
1109502004 13:63249951-63249973 CTGAAGGCCCACAGGCACTGGGG + Intergenic
1109823930 13:67692608-67692630 CCGCAGGTCCAGAGGCCCAGGGG - Intergenic
1113423861 13:110191900-110191922 CAGAAATCCCAGAGACCCTGAGG + Intronic
1113628469 13:111863946-111863968 CTGAAGAGCAAGAGGCTCTGTGG + Intergenic
1113678306 13:112223270-112223292 CAGATGTGCCAGCAGCCCTGTGG - Intergenic
1113761728 13:112852698-112852720 CAGATGGGACAGAGCCCCTGGGG + Intronic
1113787713 13:113011357-113011379 CAGAGAGTCCAGAGGCACTGCGG + Intronic
1113801619 13:113089533-113089555 CAGAACGCCCTGAGGACCTGAGG - Intronic
1113894750 13:113756814-113756836 AGCAAAGGCCAGAGGCCCTGCGG + Intergenic
1113895994 13:113764832-113764854 CAGCAGGTACAAAGGCCCTGTGG + Intronic
1114266325 14:21074604-21074626 CAGAAGGGCCTGGGGCCTCGGGG + Exonic
1115495528 14:34000627-34000649 CAGTATGGTAAGAGGCCCTGAGG - Intronic
1116344887 14:43780234-43780256 CAGAAAGGGCAAAGGGCCTGAGG + Intergenic
1117919004 14:60708068-60708090 CAGCAGGTACAAAGGCCCTGAGG - Intergenic
1118734525 14:68691893-68691915 TTGAAGGGGCAGAGTCCCTGGGG - Intronic
1119484477 14:74978751-74978773 CAGCAAGGCCAGAGGCCCACTGG - Intergenic
1119526072 14:75323449-75323471 CAGTAGGTGCAGAAGCCCTGAGG - Intergenic
1119729719 14:76943268-76943290 CAGAAAGTGCAAAGGCCCTGTGG - Intergenic
1119856503 14:77904957-77904979 CAGATGGGCAGGAGGACCTGGGG - Intronic
1120048615 14:79838636-79838658 CAGAAGTGCCAGAGGCCATCTGG - Intronic
1120719865 14:87879192-87879214 CAGAAAGGCCAGGGCCCCTAGGG + Intronic
1121729146 14:96174229-96174251 CAGAAGGGCCTGGGGCTCAGAGG + Intergenic
1121960081 14:98251488-98251510 CAGCAGGTGCAAAGGCCCTGTGG + Intergenic
1122162042 14:99791973-99791995 CTGAAGGGCCACAGGTGCTGCGG - Intronic
1122863677 14:104593935-104593957 CAGGCCGGCCAGAGGCCCCGAGG + Intronic
1122976565 14:105173304-105173326 TAGAAGGGCCAGGGGGCCAGCGG - Intronic
1123027859 14:105436961-105436983 CAGAAGTGACAGGGGGCCTGTGG - Intronic
1123028166 14:105438359-105438381 AAGAAGGGCCTGAGCCCTTGGGG + Intronic
1124341148 15:28889712-28889734 CAGCAGGTGCAAAGGCCCTGAGG - Intronic
1125523273 15:40359692-40359714 GAGAGGGGCCAGAGGCCCCAGGG - Intronic
1127071014 15:55289024-55289046 CAGAAGACCCTGAGGCCATGTGG + Intronic
1127289112 15:57554601-57554623 TAGAAGGGCCAGAGGCCCAGAGG - Intergenic
1127735036 15:61831863-61831885 CACAAGGTCCACTGGCCCTGGGG + Intergenic
1128232844 15:66047719-66047741 CAGGAGGCCCAGTGGGCCTGGGG + Intronic
1128911318 15:71518083-71518105 CAGAAGTGCAAGATGCTCTGGGG + Intronic
1129177932 15:73853318-73853340 CAGAAGACCCAGAGGACCTCGGG - Intergenic
1129298163 15:74611081-74611103 AGGAAGGGCCAGGGTCCCTGTGG - Intronic
1129333192 15:74838220-74838242 CAGGGTGGCCAGAGGCCCTGTGG + Intronic
1129683054 15:77669137-77669159 CAGCAGAGGCAGAGGCCCAGTGG - Intronic
1130235169 15:82126639-82126661 CAGAAGGCCCAGAGGACCTGTGG + Intergenic
1130321838 15:82848457-82848479 CAGTGGGGCCAGCGGGCCTGTGG - Intronic
1131265278 15:90911920-90911942 GAGGAGGGGCAGAGGCCCAGCGG + Intronic
1131844219 15:96471644-96471666 TAGAAGGTCCAAAGGCCCTGGGG - Intergenic
1132386983 15:101407692-101407714 GACACGGGCCAGAGGCCTTGTGG - Intronic
1132484440 16:183156-183178 CAGGAGGCTCAGGGGCCCTGAGG + Intergenic
1132552015 16:557399-557421 CAGGGTGGCCACAGGCCCTGGGG + Intergenic
1132640486 16:976137-976159 GAGAAGGGACACAGGGCCTGGGG - Intronic
1132688302 16:1171349-1171371 CAGATGGGCCAGTGGCCCTGGGG + Intronic
1132890827 16:2203769-2203791 CTGAAGGGCCTGAGTCCTTGCGG + Intergenic
1133003127 16:2861070-2861092 CACATGGATCAGAGGCCCTGAGG - Intergenic
1133638762 16:7696876-7696898 CAGCAGGTGCAGAGACCCTGTGG + Intronic
1133702828 16:8325232-8325254 CAGCACAGGCAGAGGCCCTGTGG - Intergenic
1133873513 16:9711524-9711546 CAGAATGTGCAAAGGCCCTGAGG - Intergenic
1133989164 16:10691518-10691540 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1134040885 16:11067444-11067466 CAGAAGAAGCAAAGGCCCTGGGG + Intronic
1134084291 16:11345881-11345903 CCGCAGGGGCAGAGGCCCGGAGG - Intronic
1134104467 16:11476071-11476093 CAGCAGGTGCAAAGGCCCTGGGG + Intronic
1134223607 16:12374718-12374740 CAGAAAGTCCAGACGCCTTGAGG + Intronic
1135641318 16:24122213-24122235 CAGCAGGTGCAAAGGCCCTGGGG + Intronic
1135641452 16:24123254-24123276 CAGCAGGTGCAAAGGCCCTGTGG + Intronic
1135913949 16:26586735-26586757 CAGCAGGGGCAAAGGCCCTGGGG + Intergenic
1136061064 16:27726803-27726825 CAGCAGGAGCAAAGGCCCTGCGG + Intronic
1136089963 16:27911624-27911646 CAGCAGGTGCACAGGCCCTGAGG - Intronic
1138008337 16:53357217-53357239 CAGATGAGGGAGAGGCCCTGAGG + Intergenic
1138497072 16:57415347-57415369 CAAAAGGGCCGCAGGCCATGAGG + Intronic
1138573697 16:57892744-57892766 CAGCATGTGCAGAGGCCCTGGGG - Intronic
1138604300 16:58078017-58078039 TGGCACGGCCAGAGGCCCTGAGG + Intergenic
1138606663 16:58094230-58094252 CAGCATGTGCAGAGGCCCTGGGG - Intergenic
1139229932 16:65273876-65273898 CATAAGGGCCATTGGCCCTGTGG + Intergenic
1139335973 16:66231542-66231564 GAGAAGGGACAGAGGACCAGCGG + Intergenic
1139476446 16:67204922-67204944 TAGACAGGCCAGAGCCCCTGGGG + Intergenic
1139717837 16:68827848-68827870 CAGTAAGGACAGAGGTCCTGAGG - Intronic
1139958263 16:70703599-70703621 CACACAGCCCAGAGGCCCTGTGG + Intronic
1140330769 16:74054712-74054734 CTGAAGGGCCAGATAGCCTGTGG + Intergenic
1140412947 16:74752476-74752498 CAGCAGGTGCAAAGGCCCTGAGG - Intronic
1141376439 16:83535183-83535205 CAGCATGTGCAGAGGCCCTGGGG + Intronic
1141619257 16:85228106-85228128 CAGCACGGGCAGAGGCCCCGAGG + Intergenic
1141658627 16:85429694-85429716 CAGTGGGGGCAAAGGCCCTGGGG - Intergenic
1141661113 16:85442083-85442105 CAGCAGGTGCAAAGGCCCTGAGG - Intergenic
1141674576 16:85510824-85510846 CGGCAGGTGCAGAGGCCCTGAGG - Intergenic
1141821515 16:86449473-86449495 CAGAGGGGCCTCAGGGCCTGGGG - Intergenic
1141838666 16:86559977-86559999 CAGCAGGCCCAAAGGCCATGCGG + Intergenic
1142160146 16:88553147-88553169 CAGCATGGCCAGAGGCCCACAGG + Intergenic
1142266734 16:89067369-89067391 GAGAAGGGCCACAGGTCTTGGGG - Intergenic
1142433096 16:90040968-90040990 CACCTGGGCCAGAGGCACTGTGG + Intronic
1142744675 17:1949935-1949957 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1143516124 17:7420109-7420131 CAAACAGGCCAGAGGCCCAGTGG + Intergenic
1143609899 17:8012205-8012227 CAGAAGGCCCTGCGGCCCTCTGG + Exonic
1143730582 17:8880602-8880624 CAGACTGGACAGAAGCCCTGGGG - Exonic
1143946804 17:10600260-10600282 CAGCAAGTGCAGAGGCCCTGGGG + Intergenic
1144106486 17:11991017-11991039 CAGAAGCTCCCCAGGCCCTGAGG + Exonic
1144487871 17:15682568-15682590 CAGCAGGGCCATGGACCCTGGGG + Intronic
1144517133 17:15926509-15926531 CAGTATGTCCAAAGGCCCTGTGG + Intergenic
1144578791 17:16446466-16446488 CAGAGGGCACAAAGGCCCTGAGG + Intronic
1144655081 17:17030013-17030035 CAGAAAGGACAGAGGCAGTGAGG - Intergenic
1144743586 17:17598216-17598238 CAGGAGGTGCAAAGGCCCTGTGG - Intergenic
1144752959 17:17662706-17662728 CAGTAAGTGCAGAGGCCCTGAGG - Intergenic
1144786013 17:17831997-17832019 CAGAGGGGTCAGAGGCTATGTGG - Intronic
1144847648 17:18228344-18228366 CAGTAGGTGCAAAGGCCCTGAGG + Intronic
1144886523 17:18466837-18466859 CAGAAGGCCCAGACACCCTCAGG + Intergenic
1144913152 17:18699722-18699744 CAGCAGGGCCATGGACCCTGGGG - Intronic
1145145685 17:20477471-20477493 CAGAAGGCCCAGACACCCTCAGG - Intergenic
1145763668 17:27443272-27443294 CTGAAGGCCCAGAGACCCTCAGG + Intergenic
1145798596 17:27669732-27669754 GAGAAGGGCAAGAGGTCCTCTGG - Intergenic
1145942469 17:28749804-28749826 AAGAAGGGAGACAGGCCCTGGGG - Exonic
1146162154 17:30565865-30565887 CAGAGGGAGCAGAGTCCCTGGGG + Intergenic
1146827022 17:36031853-36031875 CAGAAAAGGCAAAGGCCCTGGGG - Intergenic
1146831028 17:36069815-36069837 CACAAGGGACAGCGGGCCTGGGG - Intronic
1147120356 17:38331854-38331876 CAGAAGATCCAGAGGCTCAGAGG - Intronic
1147652697 17:42071434-42071456 CAGGAGGGACTGAGGCCCTCTGG - Intergenic
1147853461 17:43460076-43460098 CAGCAGGTACAAAGGCCCTGAGG - Intergenic
1147927228 17:43953427-43953449 GAGCAGGGCCAGAAGCACTGTGG + Exonic
1147953382 17:44119390-44119412 CAGAAGGGGCACAGCCCCAGTGG + Intronic
1148673604 17:49431925-49431947 CAGGAGCTCCAGAGGGCCTGTGG + Intronic
1148910658 17:50940644-50940666 CAGCAAGTGCAGAGGCCCTGTGG - Intergenic
1149650020 17:58270982-58271004 CAGGAGGGCCCCAGGCCCTTGGG + Intronic
1149869817 17:60171345-60171367 ATGAAAGGCCACAGGCCCTGGGG + Intergenic
1150221082 17:63496319-63496341 CAGAAGGGCCTGGGGCCCAGTGG + Intronic
1150485121 17:65537876-65537898 CAGAAGGGCCAGAGGCCCTGGGG + Intronic
1150651982 17:67016354-67016376 CTGAAGGTCCATGGGCCCTGGGG - Intronic
1151577060 17:74958226-74958248 CAGGAGGGACAGAGGCACCGTGG + Intronic
1151815621 17:76470144-76470166 CAGGAGGTCCAGAGGCCTCGTGG - Intergenic
1151990242 17:77570085-77570107 CAGAAGGGCCACAGCCTCTCTGG - Intergenic
1152020569 17:77778341-77778363 CATCAGGGCCAGAGGCAGTGTGG - Intergenic
1152152217 17:78609306-78609328 CAGAAGGGCCAGGGGGGATGGGG + Intergenic
1152261559 17:79269972-79269994 GAGAAGCAGCAGAGGCCCTGAGG - Intronic
1152417016 17:80169251-80169273 CAGCAGGTGCAAAGGCCCTGGGG + Intergenic
1152463598 17:80454006-80454028 CAGCAGGTGCAAAGGCCCTGAGG + Intergenic
1152577255 17:81148293-81148315 CAGAATGGCCACCTGCCCTGGGG + Intronic
1152679201 17:81656937-81656959 CAGCAGGTGCAAAGGCCCTGGGG - Intronic
1153012449 18:551413-551435 CAGAAGGCTCTGAGGTCCTGGGG - Intergenic
1153697478 18:7658951-7658973 CAGAAAGGGCAAAGGCCCTGAGG - Intronic
1154025237 18:10701339-10701361 CAGAAGGACAGGAGTCCCTGAGG + Intronic
1155271158 18:24142421-24142443 CAGAAGGGCCAGTGCCTGTGTGG + Intronic
1156218890 18:35030903-35030925 CAGAAAGTGCAAAGGCCCTGAGG - Intronic
1156392190 18:36660726-36660748 GAGATGTTCCAGAGGCCCTGGGG + Intronic
1156460496 18:37318993-37319015 CAGAAGGGCCACCTCCCCTGAGG + Intronic
1156526239 18:37769887-37769909 CCCAAGAGCCAGAGGGCCTGAGG - Intergenic
1157880681 18:51318470-51318492 CACTAGAGCCAGAGTCCCTGGGG - Intergenic
1157915806 18:51662684-51662706 CAGAGGGGCCAGAGTCACCGAGG + Intergenic
1157963991 18:52187767-52187789 CAGAAGGGCCACAGTCTCTCTGG + Intergenic
1158878062 18:61751963-61751985 CAGAGGGGTCAGGGGCCTTGTGG - Intergenic
1159096584 18:63908778-63908800 CAGAAAGGCAAGAGGCCCTTGGG + Intronic
1159950272 18:74478035-74478057 CAGGAGGGCCAGGAGACCTGGGG - Intergenic
1160103618 18:75947697-75947719 GAGAAGAGCCAAAGGCTCTGTGG + Intergenic
1160705000 19:525480-525502 CAGCACGTCCAGGGGCCCTGAGG - Intergenic
1160778759 19:868631-868653 AAGCATGGGCAGAGGCCCTGTGG - Intronic
1160856712 19:1221094-1221116 CTGCTGGACCAGAGGCCCTGTGG - Intronic
1161068834 19:2250646-2250668 CGGGAGGGGCAGAGGCTCTGCGG - Exonic
1161273378 19:3402789-3402811 CAGAATGTGCAAAGGCCCTGAGG + Intronic
1161277495 19:3426766-3426788 CAGAATGTGCAGCGGCCCTGAGG - Intronic
1161455200 19:4366449-4366471 CACAGAGGCCAGAGGGCCTGGGG + Intronic
1161553771 19:4929007-4929029 TAGAGGGGCCTGAGACCCTGAGG + Intronic
1161605655 19:5213378-5213400 CAGCCTGGGCAGAGGCCCTGGGG - Intronic
1161939681 19:7394827-7394849 CAGTAGGGCCGGGGGCTCTGAGG - Intronic
1162080378 19:8214445-8214467 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1162085636 19:8247338-8247360 CAGCAGGTGCAAAGGCCCTGAGG - Intronic
1162101883 19:8343638-8343660 CAGCATGTGCAGAGGCCCTGCGG - Intronic
1162314935 19:9933074-9933096 CAGAAGGTGCAAAGGCCCTGGGG - Intronic
1162360710 19:10218535-10218557 CAGCAGGTGCAAAGGCCCTGGGG + Intronic
1162461989 19:10818767-10818789 AAGAAGGGCCAGGGGCACTGTGG + Intronic
1162810881 19:13163837-13163859 CAGCAGGGCTAGGGCCCCTGAGG - Intergenic
1163251231 19:16127540-16127562 CACAAGGGGCAGAGGGCCTCGGG + Intronic
1163253100 19:16138436-16138458 CAGCACGGGCAAAGGCCCTGTGG - Intronic
1163520167 19:17787468-17787490 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1163525215 19:17816811-17816833 CAGAGTGGCCTGAGGCCCAGAGG - Exonic
1163703510 19:18798995-18799017 CAGCAGGGGCAAAGGCCCAGAGG + Intergenic
1164227052 19:23255117-23255139 CAGAAGGTCCTGAGGACATGTGG + Intergenic
1164658156 19:29939774-29939796 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1164677802 19:30113404-30113426 CAGCAGGGGCAATGGCCCTGCGG - Intergenic
1165309136 19:35020015-35020037 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1165394346 19:35556202-35556224 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1165402201 19:35608884-35608906 CTGAAGGAGCAGAGCCCCTGTGG - Intergenic
1165765195 19:38346212-38346234 CAGGAGAAACAGAGGCCCTGAGG + Intronic
1166078049 19:40425464-40425486 CAGAGGGGCCAGAATCCCCGGGG - Intronic
1166288969 19:41849638-41849660 GAGAGGGGCCAGAGGCCATTAGG + Intronic
1166313653 19:41976666-41976688 CAGGAGAGCCAGAGGACCAGGGG + Intronic
1166563697 19:43750293-43750315 CAGCAAGCGCAGAGGCCCTGAGG - Intronic
1166944764 19:46390143-46390165 TGGAAGGGGCAGGGGCCCTGAGG - Intronic
1167041637 19:47026325-47026347 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1167348404 19:48960996-48961018 CAGAAGGCCCAGGGTCCCAGAGG - Exonic
1167471716 19:49679412-49679434 CAGAGGTGGCAGATGCCCTGTGG + Intronic
1167492246 19:49799537-49799559 CAGAAAGACCAGAGGCTCAGAGG + Intronic
1167508005 19:49881285-49881307 GAGAAGGCCCAGGAGCCCTGGGG - Exonic
1167640060 19:50676429-50676451 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1167741851 19:51328704-51328726 GAGGAGGGCCAGGAGCCCTGGGG - Exonic
1168073549 19:53965918-53965940 TAGCAGGCGCAGAGGCCCTGAGG + Intronic
1168239577 19:55082360-55082382 CAGGGGGGCCCGAGGGCCTGGGG - Intronic
1168320658 19:55507729-55507751 GAGAAGGCCCTGAGGCCCTGAGG + Intronic
1168324070 19:55529451-55529473 CAGCAAGTGCAGAGGCCCTGGGG + Intergenic
1168598290 19:57696556-57696578 CAGAGGGAGCAGAGGGCCTGGGG + Intronic
925196598 2:1930966-1930988 TAGAGGGGCCGGAGGACCTGTGG + Intronic
925408808 2:3626984-3627006 CAGAAGAGCCAGTGGGCCAGGGG - Intronic
926196449 2:10766214-10766236 CAGCAGGGGCAGAGGCTCCGGGG + Intronic
927012096 2:18914499-18914521 AAAAAGGGCCAGAGACCCCGTGG + Intergenic
927245329 2:20952869-20952891 CAGAAGAGCCTGGCGCCCTGCGG - Intergenic
927606351 2:24490792-24490814 CGGAGCGGCGAGAGGCCCTGCGG - Intergenic
928407328 2:31024493-31024515 CAGCAGGTGCAAAGGCCCTGAGG - Intronic
929199056 2:39216300-39216322 CAGAATAGCAAGAGGCCCTGAGG + Intronic
929551380 2:42895308-42895330 CAGAAGGGCCAGGGGCAGTGTGG - Intergenic
929907183 2:46056359-46056381 CAAACGGGCCAGAGGTACTGAGG - Intronic
932235037 2:70114175-70114197 CAGAAGGGCCAGGGGCATGGTGG - Intergenic
932481114 2:72039934-72039956 CTGAAGGGGCAGACGTCCTGGGG + Intergenic
932882415 2:75516061-75516083 ACGAGGGGCCAGGGGCCCTGCGG + Intronic
933555578 2:83826502-83826524 CAGTAGGACCAGAGTCCCAGAGG + Intergenic
933714450 2:85349905-85349927 CACAAGCTCCAGAGGGCCTGGGG + Intronic
933943669 2:87266236-87266258 CAGCCAGGGCAGAGGCCCTGAGG + Intergenic
934945999 2:98542226-98542248 CAGAGCGGCCTGAGGCCATGGGG + Intronic
935077962 2:99764176-99764198 ATGAAAGGCCAGATGCCCTGTGG - Intronic
936083481 2:109451076-109451098 CAGGAGGTGCTGAGGCCCTGCGG - Intronic
936287588 2:111192693-111192715 CACAAGGGTAAGAGGCCCAGAGG - Intergenic
936336551 2:111595343-111595365 CAGCCAGGGCAGAGGCCCTGAGG - Intergenic
936792268 2:116164372-116164394 TCGCAGGTCCAGAGGCCCTGGGG + Intergenic
937072160 2:119072771-119072793 CAGCAGGTGCACAGGCCCTGAGG - Intergenic
937120580 2:119437626-119437648 CTGCAGGGCCAGAGGCCAGGAGG + Exonic
937267311 2:120624738-120624760 CAGAAGGGCTAGAAGCTGTGAGG - Intergenic
937549989 2:123076025-123076047 GAGAAGAGACAGAGGCCATGAGG - Intergenic
937829375 2:126403075-126403097 CTGGTGGGACAGAGGCCCTGGGG - Intergenic
937885303 2:126895485-126895507 GAGAAGTGGCTGAGGCCCTGAGG - Intergenic
938377572 2:130818909-130818931 CAGCAGGTGCAAAGGCCCTGAGG + Intergenic
939728542 2:145753449-145753471 CAGACGGGCCACAGGCACTCAGG - Intergenic
939734009 2:145820855-145820877 CAGAAAGTGCAAAGGCCCTGAGG - Intergenic
940255539 2:151724370-151724392 CAGAAGGAGCAGAGGATCTGTGG + Intronic
941813304 2:169775535-169775557 CAGTAGGTACAAAGGCCCTGAGG + Intronic
942302305 2:174573649-174573671 CAGCAGGTGCAGAGGCCCTGAGG + Intronic
942639276 2:178043935-178043957 CAGCATGGACAGAGGCCTTGAGG - Intronic
944605626 2:201349272-201349294 CAGCAAGTCCAAAGGCCCTGGGG - Intronic
945156634 2:206846671-206846693 CAGAGGTGCCAGAGGATCTGGGG - Intergenic
945884895 2:215364779-215364801 CAGGAGGGGCAGAGACCCTTCGG - Intronic
945947101 2:216004982-216005004 CAGAAAGTGCAGAGGCGCTGAGG + Intronic
946146585 2:217735585-217735607 CAGCAGGAGCAAAGGCCCTGAGG - Intronic
946166536 2:217867723-217867745 CAGCAGGTGCAAAGGCCCTGAGG - Intronic
947165624 2:227258593-227258615 CAGAAGGGCAAGCTGACCTGAGG + Intronic
947217315 2:227761019-227761041 CAGTAGGTGCAAAGGCCCTGAGG - Intergenic
948308523 2:236968261-236968283 GGGAGGGGCCTGAGGCCCTGGGG - Intergenic
948342511 2:237266112-237266134 CAGCTGGGCCAGAGGACATGTGG - Intergenic
948449468 2:238060508-238060530 CAGCAGGGCCAGGGCCCCGGGGG - Intronic
948508950 2:238450199-238450221 CCGATGGGCCAGAGTCCTTGTGG + Exonic
948537214 2:238655125-238655147 CAAATAGCCCAGAGGCCCTGAGG - Intergenic
948689138 2:239691045-239691067 CAGAAGGCCCAGACGAGCTGCGG - Intergenic
1168908411 20:1425415-1425437 CAGCAAGTGCAGAGGCCCTGGGG - Intergenic
1168978290 20:1984202-1984224 CAGAAAGTGCAAAGGCCCTGAGG - Intronic
1169704153 20:8483965-8483987 CAACAGGTCCAAAGGCCCTGAGG - Intronic
1169781973 20:9319562-9319584 CTGAAGGGCCAGAGAACCAGGGG + Intronic
1170436723 20:16338112-16338134 CAGAAGAGGCTGAGGTCCTGGGG - Intronic
1170846849 20:19969378-19969400 CAGCAGGTGCAAAGGCCCTGGGG - Intronic
1170947684 20:20906296-20906318 CATAAGGGACAAAGGCTCTGAGG - Intergenic
1171349971 20:24494661-24494683 CAGCAGGGACCGGGGCCCTGAGG + Intronic
1171525591 20:25807715-25807737 CAGAAGGGGCAGATGCCCCAGGG + Intronic
1171551236 20:26048169-26048191 CAGAAGGGGCAGATGCCCCAGGG - Intergenic
1171573093 20:26272302-26272324 CAGAAGGGACAGATGCCCCAGGG - Intergenic
1171837772 20:30173123-30173145 CAGAAGGGTCAGATGCCCCAGGG + Intergenic
1171856118 20:30344991-30345013 CAGAAGGGGCAGATGCCCCAGGG + Intergenic
1172022313 20:31923602-31923624 CACAAGGGCAAAAGGCCCTGAGG + Intronic
1172227944 20:33317621-33317643 CAGAACGTGCAAAGGCCCTGAGG - Intergenic
1172767333 20:37357870-37357892 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1172900623 20:38332024-38332046 CAGCAGGGGCAAAAGCCCTGTGG + Intronic
1173178143 20:40780773-40780795 CAGCAAGTCCAAAGGCCCTGAGG + Intergenic
1173850367 20:46214121-46214143 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1173917994 20:46724010-46724032 CACAAAGTACAGAGGCCCTGAGG - Intronic
1174043254 20:47714822-47714844 CAGCAAGGGCAAAGGCCCTGGGG - Intronic
1174054847 20:47791406-47791428 CAGAAAGTGCAAAGGCCCTGAGG - Intergenic
1174076331 20:47939898-47939920 CAGAAGGGCCAGAGAAACTGTGG + Intergenic
1174087375 20:48018766-48018788 CAGCAGGTGCACAGGCCCTGGGG - Intergenic
1174128913 20:48328204-48328226 CAGCAGGTGCACAGGCCCTGGGG + Intergenic
1174454576 20:50640193-50640215 CTGGAGTGGCAGAGGCCCTGTGG - Intronic
1174472221 20:50769528-50769550 CTGGAGTGGCAGAGGCCCTGTGG + Intergenic
1174478025 20:50811059-50811081 CAGCAGGTGCAAAGGCCCTGCGG + Intronic
1174514824 20:51083643-51083665 CAGCAGGTGCAAAGGCCCTGAGG + Intergenic
1174557622 20:51407067-51407089 CAGCAGGTGCAAAGGCCCTGGGG - Intronic
1174619505 20:51863305-51863327 CAGAAGTGTCAGAAGACCTGGGG + Intergenic
1175136725 20:56829811-56829833 CAGCAGTGGCAGATGCCCTGAGG - Intergenic
1175182085 20:57155801-57155823 CAAATGGCCCTGAGGCCCTGGGG - Intergenic
1175294759 20:57900613-57900635 GTGAAGGGCTCGAGGCCCTGTGG - Intergenic
1175311025 20:58011647-58011669 AAGAAGGGCCGGGGCCCCTGAGG + Intergenic
1175404322 20:58716909-58716931 CAGAAGAGGCAGAGGTCCTGAGG + Intronic
1175764038 20:61580914-61580936 CAGCAGGACCCGAGGACCTGAGG + Intronic
1176923551 21:14719171-14719193 CAGAAGTGCCTGAAGCCCCGGGG + Intergenic
1177406404 21:20673700-20673722 CAGAACTGCCCAAGGCCCTGGGG + Intergenic
1179195726 21:39160792-39160814 CAGAAGGAACAGAAACCCTGGGG - Intergenic
1179791759 21:43759898-43759920 CAGAAGGACCCCAGGCCCTGGGG + Exonic
1179939046 21:44626615-44626637 CAGGAGGCACAGAGGCCATGGGG + Intronic
1180004384 21:45013331-45013353 CAGAAGGCCCACCGGCCCTCTGG + Intergenic
1180140956 21:45893134-45893156 CACAACTGCCATAGGCCCTGAGG - Intronic
1180170189 21:46054606-46054628 CAGAGGGGTCAGAGGCCCAGTGG - Intergenic
1180190278 21:46159596-46159618 GAGCATGGCCAGAGGCTCTGTGG - Intergenic
1180574160 22:16757184-16757206 CAGAAGGGGCAGATGCCCCAGGG + Intergenic
1180794164 22:18593865-18593887 CAGATGGGCCAGAGGCGCCTGGG + Intergenic
1181013686 22:20056477-20056499 CAGAGGGGCTCGAGGCCCTGAGG - Intronic
1181021320 22:20104876-20104898 CTGTAGGGCCAGTGTCCCTGTGG + Intronic
1181227574 22:21401455-21401477 CAGATGGGCCAGAGGCGCCTGGG - Intergenic
1181251076 22:21533384-21533406 CAGATGGGCCAGAGGCGCCTGGG + Intergenic
1181671906 22:24429540-24429562 CAGGAAGGTCAGAGGCCCCGGGG - Intronic
1181920144 22:26314354-26314376 CAGAATGTGCAAAGGCCCTGTGG + Intronic
1181952125 22:26562110-26562132 CAGGAGGCCCAGCGGCCCGGCGG + Intronic
1181971722 22:26695666-26695688 CAGCAGGAGCAAAGGCCCTGAGG + Intergenic
1182053003 22:27327649-27327671 CAGCAGGTGCAAAGGCCCTGAGG + Intergenic
1182063666 22:27415728-27415750 CAGGAGGACCTGGGGCCCTGGGG + Intergenic
1182517061 22:30864928-30864950 CTTAGGGGGCAGAGGCCCTGCGG - Intronic
1183058666 22:35322197-35322219 CAGAATGGCAAGAGGCCATTTGG + Intronic
1183184700 22:36285336-36285358 AAGAAGGGCCAGTGACCTTGGGG + Intronic
1183585527 22:38750964-38750986 CAGCAGGGCCAGCGGGCTTGTGG - Exonic
1183669546 22:39264451-39264473 CAGCAGGTGCAAAGGCCCTGTGG + Intergenic
1184406246 22:44302613-44302635 TAGCAGGGGCAAAGGCCCTGGGG + Intronic
1184406260 22:44302653-44302675 CAGCAGGGGCAAAGGCCCTGGGG + Intronic
1184406274 22:44302693-44302715 CAGCAGGGGCAAAGGCCCTGGGG + Intronic
1184406288 22:44302733-44302755 CAGCAGGGGCAAAGGCCCTGGGG + Intronic
1184406302 22:44302773-44302795 CAGCAGGGGCAAAGGCCCTGGGG + Intronic
1184406316 22:44302813-44302835 CAGCAGGGGCAAAGGCCCTGGGG + Intronic
1184406330 22:44302853-44302875 CAGCAGGGGCAAAGGCCCTGGGG + Intronic
1184406344 22:44302893-44302915 CAGCAGGGGCAAAGGCCCTGGGG + Intronic
1184406356 22:44302933-44302955 CAGCAGGGGCAAAGACCCTGGGG + Intronic
1184539095 22:45107878-45107900 CAGCAGGTGCAAAGGCCCTGGGG - Intergenic
1184901232 22:47447858-47447880 CAGCAGGTGCAAAGGCCCTGTGG + Intergenic
1185281064 22:49970119-49970141 CAGCAGGTGCAAAGGCCCTGAGG + Intergenic
949301026 3:2584308-2584330 CAGAAAGGCCAGAAGGCATGCGG - Intronic
949375521 3:3384931-3384953 TAGCATGACCAGAGGCCCTGTGG - Intergenic
949877314 3:8634698-8634720 CAGCAGGGCCAGAAGCCCCCGGG + Intronic
950566195 3:13771078-13771100 CAGCAGGGGCAAAGGCCCTGAGG - Intergenic
952831004 3:37565007-37565029 CAGGAGAGCCACAGGCCCTCAGG - Intronic
952970485 3:38647842-38647864 CAGAAGGGGAACTGGCCCTGGGG - Intronic
953034710 3:39201714-39201736 CAGGAGTCCCAGAGGCCATGTGG + Intergenic
953532545 3:43751754-43751776 CAGAAGCCCCAGCTGCCCTGTGG + Intergenic
953546317 3:43866089-43866111 CAGCTGGCCCAGAGGTCCTGTGG + Intergenic
953753887 3:45630501-45630523 CAGAAGGGCAGGAGGAGCTGCGG + Intronic
953916993 3:46926631-46926653 CGGCAGGGCGAGAGGTCCTGGGG + Intronic
954199716 3:49017064-49017086 CAGCAGGTGCAGAGGCTCTGGGG - Intronic
954258417 3:49421973-49421995 CAGAAGAGCTAGAGGTCATGGGG - Intronic
954283617 3:49602209-49602231 CAGCAGGTCAAGAGGACCTGAGG - Intronic
954306109 3:49726340-49726362 CAGAGCCACCAGAGGCCCTGAGG + Exonic
954338672 3:49936191-49936213 TAGCAAGGCCAAAGGCCCTGAGG - Intergenic
954379372 3:50211437-50211459 CAGCATAGGCAGAGGCCCTGAGG - Intronic
954635628 3:52069333-52069355 CAGCAGGTGCAAAGGCCCTGGGG + Intergenic
955405647 3:58624101-58624123 CAGCAAGGCCACAGGTCCTGCGG - Intronic
956969113 3:74501396-74501418 CGGAAGGGTCAGATGTCCTGTGG + Intronic
957025526 3:75177454-75177476 CAGGAAGTGCAGAGGCCCTGAGG - Intergenic
957613997 3:82505555-82505577 CAGAAGGGGCCGAGGCAATGAGG - Intergenic
959530629 3:107431172-107431194 CGGACGGGCGAGAGCCCCTGAGG - Intergenic
960023040 3:112976996-112977018 CAGAAGGGCTAAATGGCCTGTGG + Intergenic
960148263 3:114226208-114226230 AACAAGGGGCAGAGGCCATGTGG + Intergenic
960203045 3:114861062-114861084 CAAAAGGTCTAAAGGCCCTGAGG - Intronic
960502577 3:118455128-118455150 GAGATGGGACAGAGCCCCTGGGG - Intergenic
960521794 3:118663423-118663445 GAGAAGGTCCAGCGGCACTGTGG - Intergenic
960992354 3:123320230-123320252 CAGGTGGGCCACAGTCCCTGTGG - Intronic
961114427 3:124316543-124316565 CAGCAGGGGCAAAGGCCGTGAGG - Intronic
961333462 3:126156483-126156505 CAGGAGGGAAGGAGGCCCTGGGG - Intronic
961431644 3:126888192-126888214 CAGAAGAGCTGGAGGCCCTCCGG + Intronic
961482770 3:127194880-127194902 CCGAATGGGCAGAGGACCTGGGG - Intronic
961523803 3:127483927-127483949 CAGAAGAGCCTGAGCCTCTGGGG - Intergenic
961533055 3:127551598-127551620 CAGCAAGGGCAAAGGCCCTGGGG - Intergenic
961554818 3:127690558-127690580 AAGAAGGGCGGGAGCCCCTGAGG + Exonic
962396018 3:135015893-135015915 CAGACAGGACAAAGGCCCTGAGG + Intronic
963136432 3:141909577-141909599 CAGTAGGTGCAAAGGCCCTGAGG + Intronic
964059954 3:152509327-152509349 CAGAAAGTGAAGAGGCCCTGGGG + Intergenic
966077873 3:175960593-175960615 CAGAAGGACAAAAAGCCCTGGGG - Intergenic
966200867 3:177358896-177358918 CACTGGGGCCAGAGGCCCTGTGG - Intergenic
967289172 3:187902443-187902465 GAGAAGGGCCAGAGGGCTTTGGG - Intergenic
967856304 3:194120033-194120055 CAGCAGGTGCAGAGGCTCTGAGG - Intergenic
967968724 3:194984125-194984147 CAGCAGGGCGACAGGCCCAGTGG - Intergenic
968390490 4:188393-188415 GAGATGGGTCAGAGCCCCTGGGG - Intergenic
968461082 4:725406-725428 GAGGAGGGGCAGCGGCCCTGAGG + Intronic
968579191 4:1381951-1381973 CAGAAGGGACCGAGGCCGGGCGG - Intronic
969185466 4:5471107-5471129 CAGGAGGGCCACAGTCCCAGGGG + Intronic
969199319 4:5590065-5590087 CAGCATGACCAGAGGCACTGAGG + Intronic
969363501 4:6680545-6680567 CAGCATGGGCAAAGGCCCTGGGG - Intergenic
969688574 4:8690661-8690683 CAGAAGCAGCAAAGGCCCTGGGG + Intergenic
969942025 4:10742184-10742206 CAGAATATCCAAAGGCCCTGAGG - Intergenic
970049340 4:11896337-11896359 CAGTGAGGCCAGAGGCACTGGGG + Intergenic
971133854 4:23844982-23845004 AGTAAGGGCCAAAGGCCCTGAGG + Intronic
971260773 4:25054724-25054746 CAGAAGGCAGAAAGGCCCTGGGG + Intergenic
971326974 4:25652606-25652628 AAGAAGTGCCAGAGGGCCTTGGG + Intergenic
972067151 4:34962456-34962478 CAGGAGAGTCAGAGGTCCTGTGG - Intergenic
972330069 4:38056300-38056322 CAGGAGGGGCAGAGGCTCTTCGG - Intronic
973047171 4:45549174-45549196 CAGAGTGGCCAGAGGCTTTGGGG + Intergenic
973266482 4:48216131-48216153 CAGCAGGTGCAAAGGCCCTGGGG - Intronic
975496446 4:75040828-75040850 CAGCAAGTACAGAGGCCCTGAGG - Intronic
976831256 4:89317349-89317371 CAGAAGACTCAAAGGCCCTGGGG + Intergenic
977874457 4:102132078-102132100 CAGCAGGTGCAAAGGCCCTGAGG - Intergenic
979217589 4:118183835-118183857 CAGAAGGGCCAGCAGATCTGTGG + Intronic
980753080 4:137117902-137117924 AAGAAAGGCCCGAGACCCTGTGG + Intergenic
981050315 4:140303405-140303427 CAGCAGGGCCACAGGGCCTGAGG - Intronic
981578592 4:146230039-146230061 CAGAAGTGCCAGAGGTCTGGAGG - Intergenic
983375673 4:166924522-166924544 CAGAAGGGCAAGAGAGACTGTGG - Intronic
984695137 4:182771374-182771396 CAGGAGGGCTAGTGGGCCTGGGG + Intronic
985575636 5:672261-672283 CAGCAGGGCCAGGCTCCCTGGGG - Intronic
985753797 5:1701055-1701077 GGGCAGGGCCAGCGGCCCTGGGG - Intergenic
986064006 5:4218245-4218267 CACAAGGTCCAGAAGCCCAGAGG + Intergenic
986093726 5:4536012-4536034 CAGCAGGGCCACACTCCCTGAGG - Intergenic
987039890 5:14052570-14052592 CAGCAAGGGCAAAGGCCCTGAGG + Intergenic
987623948 5:20373335-20373357 CAGAATGTGCAAAGGCCCTGGGG - Intronic
988715536 5:33823598-33823620 CAGCTGGGCCAGAGTCACTGGGG - Intronic
990626922 5:57623991-57624013 CAGTGGGGGCAGAGGCCATGAGG + Intergenic
990948089 5:61270629-61270651 CCAAAGGGCCAGAGGGCCGGAGG - Intergenic
991478281 5:67047405-67047427 CAGCAAGAGCAGAGGCCCTGAGG - Intronic
991607674 5:68419925-68419947 CAGTAGTGCTAGAGGCCGTGGGG + Intergenic
992178916 5:74177805-74177827 CAGCAAGTGCAGAGGCCCTGTGG - Intergenic
992494199 5:77276237-77276259 CAGCAGGCGCAAAGGCCCTGAGG - Intronic
992970094 5:82047651-82047673 CAGCAAGGACAGAGGCCCCGAGG - Intronic
998041511 5:138953586-138953608 GAGATGGGCCAGAGTCCCTGGGG + Intronic
998182503 5:139955345-139955367 CAGCAGCGGCAGAGGCCCAGAGG + Intronic
998403643 5:141861762-141861784 CTGAGGGGCCTCAGGCCCTGGGG - Intronic
998617042 5:143752019-143752041 AAGAAGGGAGACAGGCCCTGGGG + Intergenic
999133404 5:149301256-149301278 CCAGAGGGACAGAGGCCCTGAGG - Intronic
999247692 5:150163924-150163946 CAGTATGAACAGAGGCCCTGAGG - Intergenic
999266178 5:150268352-150268374 CAGCAGGTACAGAGGCCCTGAGG - Intronic
999302894 5:150502036-150502058 GAGAGGGGCCAGAGGGCATGTGG + Intronic
999306140 5:150520954-150520976 CAGAAGGCCCTGACGCCCTGGGG + Exonic
999326496 5:150647495-150647517 CAGCAAGTCCAAAGGCCCTGGGG + Intronic
999372782 5:151066289-151066311 CAGTAAGGGCAGAGGCCCTAAGG + Intronic
1000036064 5:157448898-157448920 CAGCTAGGCCAAAGGCCCTGAGG - Intronic
1000383246 5:160647770-160647792 GAGAAGGGCCTGAGGTCCTGGGG - Intronic
1001197004 5:169682365-169682387 CAGCAGGTGCAAAGGCCCTGAGG + Intronic
1001422400 5:171597725-171597747 CAGCAGGTGCAAAGGCCCTGTGG - Intergenic
1002019587 5:176354477-176354499 CAGAGGGGAGAGAGTCCCTGAGG + Intronic
1002055497 5:176596070-176596092 CAGAAAGGCCAGAGGGTCTCAGG - Exonic
1002122995 5:177020226-177020248 CAGCAGGTACAAAGGCCCTGAGG - Intronic
1002310468 5:178310698-178310720 CACCAGGCCCAGATGCCCTGGGG - Intronic
1002448845 5:179307725-179307747 CAGCAGGTGCAAAGGCCCTGAGG - Intronic
1002782397 6:377407-377429 CAGAAGGCCGAGAGGCCCAGAGG + Intergenic
1002897868 6:1389770-1389792 CAGAAGCCCCAGAGGAGCTGAGG + Intergenic
1004320638 6:14628889-14628911 CAGAGAGGCCACTGGCCCTGAGG - Intergenic
1004613649 6:17269221-17269243 CAGACTGGCCAGAGTCACTGGGG - Intergenic
1006451387 6:34107664-34107686 CAGCAGGTACAAAGGCCCTGTGG + Intronic
1006797360 6:36740319-36740341 CAGCAGGCGCAAAGGCCCTGTGG - Intergenic
1006934739 6:37709664-37709686 CAAAAGGGCCAGGGCCCCTGAGG + Intergenic
1006934843 6:37710162-37710184 CAGAAGGTACAAAGGCCCTGAGG + Intergenic
1007630455 6:43270297-43270319 CTGCAGGGCCAGAGGCACTCTGG + Intronic
1007768176 6:44173407-44173429 CAGCAGGTGCAAAGGCCCTGAGG - Intronic
1007932826 6:45707861-45707883 CAGAAGGCACACAGGCCCTGTGG + Intergenic
1008413988 6:51217916-51217938 CAGAAAGTACAAAGGCCCTGAGG - Intergenic
1008753895 6:54770542-54770564 CGGCAGGGCCAGAGGCTCAGCGG + Intergenic
1011794349 6:90936464-90936486 CAGCAGGGCCAGAGGTGATGAGG + Intergenic
1013300721 6:108802866-108802888 CAGAAAGGACAGAGGCCTTGAGG + Intergenic
1013650027 6:112185513-112185535 CAGAGGGGACTGAGGCCCTTAGG + Intronic
1013862844 6:114657752-114657774 AAGAAGGGCCAGAAGCACTGAGG + Intergenic
1014747849 6:125220908-125220930 CAGCAGAGCCAGAGGAGCTGAGG + Intronic
1015579155 6:134704588-134704610 CAGCAGGGGGAGAGGCCATGAGG + Intergenic
1017432144 6:154381922-154381944 CAGAAGAGCCAGTGCTCCTGAGG - Intronic
1017718700 6:157229879-157229901 CAGCAGGTGCAGAGGCCCCGCGG + Intergenic
1017853016 6:158321994-158322016 AAGAAGGCCCAGAGCCACTGGGG + Intronic
1018787368 6:167118799-167118821 CTAAAGGCCCAGGGGCCCTGGGG - Intergenic
1018838084 6:167500091-167500113 CAAGGGGCCCAGAGGCCCTGAGG + Intergenic
1018984577 6:168626512-168626534 CAGACAGGCCTGAGGCACTGGGG + Intronic
1019547576 7:1585885-1585907 CAGAAAGGCCGGCAGCCCTGGGG + Intergenic
1019563967 7:1670655-1670677 CGGAAGGGAGAGAGGCGCTGGGG - Intergenic
1019733043 7:2637978-2638000 CAGAACGGCTAGGGGCACTGTGG - Intronic
1019747697 7:2709742-2709764 CAGATGGGACAGAGGTCCAGGGG - Exonic
1019848135 7:3527469-3527491 CAGCAAGTCAAGAGGCCCTGAGG + Intronic
1020245479 7:6425830-6425852 CAGAGGGGCCACAGACTCTGGGG - Intronic
1021617666 7:22519771-22519793 CAGCAGGGCCCAGGGCCCTGAGG - Intronic
1022927259 7:35069261-35069283 CAGCAGGGCCCAGGGCCCTGAGG - Intergenic
1022944247 7:35266293-35266315 GAGAAGGGACAGTGGCCTTGGGG + Intergenic
1023746336 7:43326129-43326151 CAGAGGGGCCAAAGGGGCTGGGG + Intronic
1024101034 7:46033198-46033220 CAGAAACACCAAAGGCCCTGAGG + Intergenic
1024620538 7:51153726-51153748 AAGCAGGGCCAGAGACCCTGCGG - Intronic
1024790241 7:52957666-52957688 CTGATGGGCCAAAGGCCCTGTGG + Intergenic
1025238141 7:57248733-57248755 CAGAAAGTGCAAAGGCCCTGAGG + Intergenic
1025286278 7:57664585-57664607 CAGAAGGGACAGATGCCCCAGGG + Intergenic
1025299879 7:57810377-57810399 CAGAAGGGGCAGATGCCCCAGGG - Intergenic
1025777110 7:64569461-64569483 GAGGAGGGCCAGGGGCCCTGGGG + Intergenic
1026472757 7:70708268-70708290 CAGAAGCCCAAGAGGTCCTGCGG - Intronic
1026479291 7:70764463-70764485 CAGGAGCGAGAGAGGCCCTGAGG + Intronic
1026639163 7:72109362-72109384 AAGAAGGGCTGGAGGACCTGAGG - Intronic
1027345328 7:77253872-77253894 CAGATAGGGCAAAGGCCCTGAGG + Intronic
1027441041 7:78219503-78219525 CAGTAGTACGAGAGGCCCTGAGG - Intronic
1028375009 7:90136333-90136355 CAGCAGGGCCCAGGGCCCTGAGG + Intergenic
1029436803 7:100568265-100568287 CAGCAGGGACAGGGGCCCTTTGG + Intergenic
1029813765 7:103074339-103074361 AAGAAGTGCCAGAGAGCCTGAGG - Exonic
1030105024 7:105979840-105979862 CAGAAGGCCCGGAGCCCCTGGGG - Intronic
1031999093 7:128253172-128253194 GAGATGGGATAGAGGCCCTGAGG - Intronic
1032420948 7:131778635-131778657 CAGGATGGCCAGAGGGCCTAGGG - Intergenic
1032726440 7:134593709-134593731 CACAAGTGCCACAAGCCCTGGGG - Intergenic
1033453478 7:141481996-141482018 CAGAAGGCCCCGATGCTCTGTGG + Intergenic
1034417133 7:150971154-150971176 GAGAAGGGCAGGAGGCCCAGAGG + Intronic
1035302992 7:157909600-157909622 CAGCAGGTACAAAGGCCCTGAGG - Intronic
1035328150 7:158078269-158078291 CTCAAGGGCCTGAGGACCTGAGG - Intronic
1035366329 7:158351216-158351238 CTGAAGGGGCAGAACCCCTGGGG - Intronic
1035577728 8:718776-718798 CTGAAGACCCAGAGGCCTTGGGG - Intronic
1036080379 8:5548874-5548896 CAGCAGGGACAGAAGCCATGGGG + Intergenic
1037741498 8:21612625-21612647 CAGAGGGGCTAGGGGCTCTGGGG - Intergenic
1037834656 8:22208880-22208902 CACAAAAGCCAGAGGGCCTGGGG + Intronic
1038916593 8:32031250-32031272 GAGATGGGCCTGAGGTCCTGGGG - Intronic
1038926869 8:32150487-32150509 CAGAAGGGCAAGAGGCCCTAGGG - Intronic
1039376686 8:37041649-37041671 CAGATGAGACAGAGGCCCTAAGG + Intergenic
1039923390 8:41908394-41908416 CAGCAGGTGCAAAGGCCCTGAGG - Intergenic
1041792624 8:61714253-61714275 CGGAGAGGTCAGAGGCCCTGCGG - Exonic
1045426242 8:102068427-102068449 CAGCAGGTGCAGAGGCCGTGAGG - Intronic
1046198062 8:110888971-110888993 CAGAAGTTCCAGAGGCCTGGAGG + Intergenic
1047127105 8:121974780-121974802 CAGAAGAGCCAGATGCCCTGAGG - Intergenic
1047495406 8:125405282-125405304 CAGAGGGGCCAGAGCACATGGGG + Intergenic
1048335284 8:133497947-133497969 CAGCAGGTGCAAAGGCCCTGGGG - Intronic
1048455046 8:134570113-134570135 CAGCAGGTGCAGAGGCCCGGAGG - Intronic
1048481261 8:134795879-134795901 GAGAAGGCCAAGAGGCCTTGAGG + Intergenic
1048572471 8:135667192-135667214 CAGAACAGCCTGAGGCCCAGTGG - Intergenic
1048956877 8:139544469-139544491 TTGAAGTGCCAGAGTCCCTGTGG + Intergenic
1049097542 8:140557862-140557884 CAGAAGGACGAGAGGGCCTGTGG - Intronic
1049571066 8:143370537-143370559 CACCTGGGCCTGAGGCCCTGTGG + Intronic
1049603313 8:143518057-143518079 CAGAAGGGCTGGGGGCCCTGTGG - Intronic
1049624958 8:143615765-143615787 CAGAGGCTCCAGAGGCCCTGGGG + Intronic
1049879725 8:145053408-145053430 CCGAATGGCGTGAGGCCCTGCGG + Exonic
1050037912 9:1456865-1456887 CATCTAGGCCAGAGGCCCTGGGG + Intergenic
1050679286 9:8091115-8091137 CAGAAGGGGCTGATGCACTGGGG - Intergenic
1051183990 9:14439716-14439738 CAGATGGGCCAGAGTGCCTCAGG + Intergenic
1052990415 9:34516151-34516173 CAGCTGGGGCAGATGCCCTGAGG + Intronic
1053280760 9:36818655-36818677 AGGAAGGGCCAGAGGCACGGTGG - Intergenic
1053304556 9:36974938-36974960 CAGAATGTCCAGGGGCACTGGGG - Intronic
1053463063 9:38285435-38285457 CAGCAGGTGCAAAGGCCCTGGGG - Intergenic
1054151462 9:61609204-61609226 CAGAAGGGGCAGATGCCCCAAGG - Intergenic
1054806775 9:69403295-69403317 CAGCAGTGGCAAAGGCCCTGAGG + Intergenic
1054809380 9:69422646-69422668 CAGCAAGGACAAAGGCCCTGAGG - Intergenic
1054944144 9:70776752-70776774 CAGAAGGTACAGAGGGCTTGTGG + Intronic
1056126084 9:83537768-83537790 CAGAGGGGCCAGAGTCCCTCCGG + Intronic
1056605335 9:88080613-88080635 CAGAATGTGCAAAGGCCCTGAGG + Intergenic
1056988514 9:91387882-91387904 CAGAAGGGGCTGAGAACCTGTGG - Intergenic
1057041898 9:91854030-91854052 GAGAAGGGGAAGAGGCCCAGAGG + Intronic
1057191802 9:93092570-93092592 CAGAAGGGCCAGACTCCAAGTGG + Intergenic
1059170410 9:112119424-112119446 CAGAAGGGACAGAGGCCAACAGG + Intronic
1059314990 9:113416624-113416646 CAGTAGGGCCATTAGCCCTGGGG - Intronic
1060055132 9:120406745-120406767 GAGCAAGGCCAGAGGCACTGAGG + Intronic
1060055404 9:120408790-120408812 CAGAATGGGCGCAGGCCCTGAGG - Intronic
1060223290 9:121775491-121775513 GAGAGGGGCCAGACGCCATGAGG - Intronic
1060979224 9:127783192-127783214 CAGTGGGGACTGAGGCCCTGAGG + Intergenic
1060993255 9:127860984-127861006 CAGCAGGTGCAAAGGCCCTGGGG - Intergenic
1061011782 9:127960237-127960259 CAGCAAGTGCAGAGGCCCTGAGG + Intronic
1061372829 9:130207406-130207428 CAGCAGGGGCAGAGGCTCTGAGG - Intronic
1061475418 9:130862527-130862549 CAGCAGGTACAGAGGCCCTGAGG + Intronic
1061510773 9:131059722-131059744 TGGCAGGGCCAGAGGCTCTGTGG - Intronic
1062043211 9:134413640-134413662 CAGAGGAGCCAGTGGGCCTGGGG + Intronic
1062096746 9:134707590-134707612 CTGAAGGGCCTGACGCCCTGGGG - Intronic
1062349359 9:136131554-136131576 CAGCAGGACCAGCGGCCCGGGGG - Intergenic
1062357986 9:136174032-136174054 CAGCAGGCTCAAAGGCCCTGAGG + Intergenic
1062402443 9:136378491-136378513 CAGAGTGGCCAGCAGCCCTGCGG + Exonic
1062730159 9:138104131-138104153 CAGAAGGGCCAGATGAGCTGAGG + Intronic
1186611553 X:11142816-11142838 CAGAAGGGAAAGAGGCCCTGTGG + Intronic
1186795666 X:13044489-13044511 AAGGCGGGCCAGAGGCCCTTTGG - Intronic
1186944044 X:14545307-14545329 CAGAAGGGCAAGAGGGCATAAGG + Intronic
1187399961 X:18950807-18950829 CAGAAGGGCAAGAGAGCCAGAGG - Intronic
1190388413 X:49908059-49908081 CAGCAAGGGCAAAGGCCCTGAGG + Intergenic
1191129851 X:56995785-56995807 CAGAAGGGGCAGGGGCGCAGAGG - Intergenic
1192235995 X:69296419-69296441 CCCATGGGCCAGAGACCCTGAGG + Intergenic
1192264636 X:69530125-69530147 CAGAATGGCCAGAGGGCCTCAGG + Exonic
1194537264 X:95120087-95120109 GAGATGGGACAGAGCCCCTGGGG - Intergenic
1195767473 X:108311584-108311606 CAGCGAGGGCAGAGGCCCTGAGG - Intronic
1196893149 X:120309477-120309499 CAGACGGGCCCGGGGCGCTGTGG + Intronic
1197714302 X:129695253-129695275 CAGCAGGTTCAAAGGCCCTGAGG - Intergenic
1197815775 X:130496484-130496506 CAGAACAGCTAGAGGTCCTGGGG + Intergenic
1199462661 X:148101341-148101363 CTGAAGGGGCAGAGCCCTTGTGG + Intergenic
1199545250 X:149002070-149002092 AAGAAGGACCACAGGCCCTCAGG + Intergenic
1199848819 X:151710843-151710865 CAGAAGGTTCAGAGACCCAGAGG - Intergenic