ID: 1150488918

View in Genome Browser
Species Human (GRCh38)
Location 17:65561354-65561376
Sequence CGAGCCGCGGCGTGGGCGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 249}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150488918_1150488927 4 Left 1150488918 17:65561354-65561376 CCCCGCGCCCACGCCGCGGCTCG 0: 1
1: 0
2: 2
3: 29
4: 249
Right 1150488927 17:65561381-65561403 GACCTCGCCCCCTGTAAGAGGGG 0: 1
1: 0
2: 0
3: 3
4: 33
1150488918_1150488935 21 Left 1150488918 17:65561354-65561376 CCCCGCGCCCACGCCGCGGCTCG 0: 1
1: 0
2: 2
3: 29
4: 249
Right 1150488935 17:65561398-65561420 GAGGGGGGCTTTCTTTGAAGCGG 0: 1
1: 0
2: 1
3: 13
4: 153
1150488918_1150488928 5 Left 1150488918 17:65561354-65561376 CCCCGCGCCCACGCCGCGGCTCG 0: 1
1: 0
2: 2
3: 29
4: 249
Right 1150488928 17:65561382-65561404 ACCTCGCCCCCTGTAAGAGGGGG 0: 1
1: 0
2: 1
3: 2
4: 81
1150488918_1150488936 30 Left 1150488918 17:65561354-65561376 CCCCGCGCCCACGCCGCGGCTCG 0: 1
1: 0
2: 2
3: 29
4: 249
Right 1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 59
1150488918_1150488930 6 Left 1150488918 17:65561354-65561376 CCCCGCGCCCACGCCGCGGCTCG 0: 1
1: 0
2: 2
3: 29
4: 249
Right 1150488930 17:65561383-65561405 CCTCGCCCCCTGTAAGAGGGGGG 0: 1
1: 0
2: 0
3: 3
4: 88
1150488918_1150488925 2 Left 1150488918 17:65561354-65561376 CCCCGCGCCCACGCCGCGGCTCG 0: 1
1: 0
2: 2
3: 29
4: 249
Right 1150488925 17:65561379-65561401 GCGACCTCGCCCCCTGTAAGAGG 0: 1
1: 0
2: 0
3: 2
4: 21
1150488918_1150488926 3 Left 1150488918 17:65561354-65561376 CCCCGCGCCCACGCCGCGGCTCG 0: 1
1: 0
2: 2
3: 29
4: 249
Right 1150488926 17:65561380-65561402 CGACCTCGCCCCCTGTAAGAGGG 0: 1
1: 0
2: 0
3: 3
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150488918 Original CRISPR CGAGCCGCGGCGTGGGCGCG GGG (reversed) Intronic
900100730 1:960965-960987 GGAGTCGCGTCCTGGGCGCGCGG - Intronic
900349592 1:2228301-2228323 GGAGCGGGGGCGCGGGCGCGGGG - Intergenic
900415346 1:2532122-2532144 GGAGCCATGGCGTGAGCGCGTGG - Intergenic
901050703 1:6424667-6424689 CGCGTCGCGGCGGGGGCGGGCGG + Intronic
901425950 1:9182560-9182582 CCAGCGGCGGCGTGGGCGAGGGG - Intergenic
903524109 1:23980013-23980035 TCAGCCGCCGCGTGGGAGCGAGG - Intronic
903888497 1:26554958-26554980 GGAGCAGCGGTGGGGGCGCGAGG - Intronic
904641909 1:31937842-31937864 CGGGCCGGGGCGGGGGAGCGAGG - Intronic
904768996 1:32870694-32870716 CGGAGCGCGGCGCGGGCGCGGGG + Exonic
905442694 1:38005291-38005313 CGCTCCCCGGCCTGGGCGCGGGG + Intronic
905912127 1:41662300-41662322 CGCGGCGCGGGGTGGGCGCGGGG + Intronic
907136249 1:52142151-52142173 CGAGCCGGGCCGGGGGCGCAAGG - Exonic
907767281 1:57423906-57423928 TGAGGCGCGGCGGGGGCGCGCGG - Intronic
910277595 1:85465246-85465268 CGAGCGCCGGAGTGGGCGCGCGG - Intronic
912381301 1:109249608-109249630 GCAGCCGCGGCGGGGACGCGGGG + Intergenic
912494665 1:110083900-110083922 TGAGTCTCGGCGTGGGTGCGGGG + Intergenic
917797529 1:178542742-178542764 CGGGGCCCGGCGGGGGCGCGGGG - Intronic
919403258 1:197146470-197146492 GGAGCCGCCTCGTGGGAGCGGGG - Exonic
919820441 1:201468916-201468938 AGGGCCGCGGTGTGGGTGCGCGG - Exonic
921029780 1:211327021-211327043 CGACCGGCGGGGAGGGCGCGAGG + Intronic
922766396 1:228158682-228158704 GGGGCCGCGGCGCGGGGGCGGGG - Exonic
923055920 1:230425988-230426010 CGGGCCGCGGCGCGGGCCCAGGG - Intergenic
923684140 1:236142398-236142420 CGGGCCGGGGCGGGGGCGCGCGG + Intergenic
923684150 1:236142418-236142440 CGGGCCGGGGCGGGGGCGCGCGG + Intergenic
1063115365 10:3068299-3068321 CGGGACGCGGCGGGGGTGCGCGG + Intronic
1065100404 10:22325649-22325671 CGAGCCTCGGCGGGCGTGCGGGG - Intronic
1066022854 10:31319864-31319886 CGGGCCGGGCTGTGGGCGCGCGG + Intronic
1066126463 10:32347198-32347220 CGCGCAGCGGCGCGGGCACGCGG + Intronic
1069615362 10:69803077-69803099 CTTGCCGCTGCGCGGGCGCGGGG - Intronic
1070301958 10:75210474-75210496 CGGGGCGGGGCGTCGGCGCGTGG - Intronic
1070895808 10:79982251-79982273 CGGGCGGCGGCGGGGGCGCTCGG + Intronic
1070917926 10:80166866-80166888 CGAGCTGCGGGGTGGGGGCGCGG - Intronic
1073064003 10:100747985-100748007 AGAGCCGCAGCGCGGGCCCGCGG + Intronic
1074165658 10:110871995-110872017 CGAGCAGCGGCGGGGGCCCGAGG + Exonic
1074503341 10:114044972-114044994 CGGGCGGCGGCGCGGGCGCGGGG - Exonic
1075401299 10:122163380-122163402 CGAGCCGCGGCCCGGGAGCTGGG - Intronic
1076394549 10:130129196-130129218 CTGGGTGCGGCGTGGGCGCGGGG - Intergenic
1076722053 10:132397063-132397085 CGAGCCGGGCCGGGGGCGCGCGG - Intergenic
1077044303 11:537676-537698 TGCGCCGAGGCGTGGGCGCGGGG + Intronic
1078180186 11:9004404-9004426 CGAGCAGCGGCGCGGGCGGCGGG - Intergenic
1079076710 11:17389107-17389129 GGAGCCGCGGCGCGGGCGGGCGG - Intronic
1079642994 11:22829892-22829914 AGAGCTGCGGGGTGGGGGCGGGG - Intronic
1080692170 11:34567206-34567228 CGAGCTGGTGCGTGGGCACGGGG - Intergenic
1083758394 11:64803186-64803208 CGAGCTGCGGAGCCGGCGCGGGG + Exonic
1087014613 11:93543212-93543234 CGAGCCGGCGGGCGGGCGCGGGG - Intronic
1088462164 11:110093302-110093324 CGGCCCGCGGAGAGGGCGCGCGG + Intergenic
1088630123 11:111766398-111766420 CGGGGCGGGGCCTGGGCGCGGGG - Intronic
1088647232 11:111926981-111927003 CCAGCCGCGGCCTGGGGGTGGGG - Intergenic
1089078856 11:115760101-115760123 TGACCCGCGGCGGGGGCGCTGGG - Intergenic
1089656125 11:119948129-119948151 CCAGCCGAGGGGTGGGTGCGTGG + Intergenic
1090056804 11:123430846-123430868 CGAGCCGCAGGGTGCGCCCGAGG + Exonic
1091286787 11:134412355-134412377 CCAGCCTAGGCGGGGGCGCGAGG + Intergenic
1095949443 12:47773773-47773795 CGACCAGCGCCGCGGGCGCGCGG - Intronic
1096127677 12:49131489-49131511 CCGGGCGCGGAGTGGGCGCGCGG - Intergenic
1096459468 12:51814333-51814355 CGCGGCGCGCCGGGGGCGCGGGG + Intergenic
1096647595 12:53047194-53047216 CGGGGCGCGGCGGGGGCGGGAGG + Intronic
1097190402 12:57216809-57216831 CGGCCCGCGGACTGGGCGCGAGG - Exonic
1100611416 12:96194402-96194424 ACAGCCGCGGCCGGGGCGCGCGG + Exonic
1101371844 12:104137932-104137954 CGGGCCGGGGAGCGGGCGCGGGG - Intronic
1104862169 12:131929471-131929493 AGAGACGGGGCTTGGGCGCGGGG + Exonic
1105418283 13:20231930-20231952 CGGGCCGGGGCCGGGGCGCGTGG + Intronic
1105964412 13:25371959-25371981 CGGGCTGCGGCGTGGGGGCGGGG - Intergenic
1106187797 13:27424518-27424540 CGAGCCGCGGCGGGGCCTCCTGG + Intergenic
1106422406 13:29595227-29595249 CGGGCCCCGGAGTGGGCGAGCGG - Intronic
1110318187 13:74134269-74134291 CGAGCCCCGGGGTGGGGCCGAGG + Intergenic
1110318638 13:74135696-74135718 CGGGCCGGGCCGGGGGCGCGGGG - Intergenic
1112507084 13:99981730-99981752 GGAGCTGCGGCGGGGGCGGGCGG - Intergenic
1113201069 13:107867602-107867624 CGGGCGGCGGCGGGGCCGCGGGG + Intergenic
1113682157 13:112252081-112252103 GGAGGCGGGGCGTGGGCGAGCGG + Intergenic
1113737644 13:112689920-112689942 CGAGCGCGGGTGTGGGCGCGGGG + Intergenic
1113813101 13:113154072-113154094 GGAGGCGGGGCGTGGGGGCGGGG + Intergenic
1118030359 14:61812651-61812673 CGCGGCGCGGCGGGGGCGCGCGG + Intergenic
1118849345 14:69572482-69572504 CAAGCAGCGGCGGGAGCGCGAGG - Exonic
1120809965 14:88792962-88792984 CGAGCCGAGCGGCGGGCGCGCGG + Intergenic
1120881339 14:89417147-89417169 CGCGCCGCGGCGGAGGCGAGCGG - Intronic
1120905710 14:89619243-89619265 CGGGCCGCGAGGCGGGCGCGCGG - Intergenic
1122143345 14:99675179-99675201 CTGGCCGCGGGGTTGGCGCGGGG - Exonic
1122888997 14:104724084-104724106 CGGGCAGCGGCGAGGGGGCGGGG + Intergenic
1122975412 14:105168835-105168857 CGCGCCGCGGGGTGGGGCCGGGG + Intergenic
1123037993 14:105479079-105479101 CGAGCCCCGGGGCGGGGGCGGGG - Intronic
1124652340 15:31483314-31483336 GGAGCTGCGGCGGCGGCGCGAGG - Exonic
1127931649 15:63600995-63601017 AGGGCCGCGGCGGGCGCGCGCGG - Intronic
1128454951 15:67827105-67827127 GGAGCGGCGGCGGCGGCGCGGGG + Intronic
1128547721 15:68579137-68579159 CGAGCCGCCGGCGGGGCGCGGGG + Exonic
1128758833 15:70201093-70201115 CGAGCCTGGGCCTGGGCGAGGGG + Intergenic
1129189135 15:73927406-73927428 CGGGCGGCGGCGTGGGCGCGGGG + Exonic
1132365174 15:101251709-101251731 CTAGCGGCGGCTCGGGCGCGAGG + Exonic
1132480680 16:164902-164924 CGGGCCGGGGCGGGGTCGCGGGG + Intronic
1132559901 16:588951-588973 CGGGCCCCGGCGTGGGGTCGGGG - Intergenic
1132719646 16:1309478-1309500 GGACCCGGGGCGCGGGCGCGCGG + Intronic
1132843532 16:1989934-1989956 CCGGCCGCGGCGGGGACGCGCGG - Exonic
1134149777 16:11796926-11796948 CGGGCCGGGGCCTGTGCGCGCGG - Intronic
1134149928 16:11797411-11797433 GGAGCCCCGGCGTCGACGCGCGG + Intergenic
1134519352 16:14911620-14911642 TGAGCCGCGGCCTCCGCGCGCGG + Intronic
1134554581 16:15154608-15154630 TGAGCCGCGGCCTCCGCGCGCGG - Intergenic
1134707022 16:16310275-16310297 TGAGCCGCGGCCTCCGCGCGCGG + Intergenic
1134960518 16:18401849-18401871 TGAGCCGCGGCCTCCGCGCGCGG - Intergenic
1140500941 16:75433106-75433128 CGGCCCGAGGCGTGTGCGCGTGG - Intronic
1141435828 16:83999219-83999241 CGAGACTCGGCGTGGCCACGAGG + Intronic
1142005978 16:87689809-87689831 CGGGCGGCGGGGTGGCCGCGGGG - Exonic
1142065130 16:88057932-88057954 CGAGGCTCGGTGTGGGCCCGTGG + Intronic
1142374722 16:89701163-89701185 CGAGCTGCGACGGGGCCGCGCGG - Exonic
1142762301 17:2049868-2049890 CGAGCCGCGGGCTGGGGACGCGG - Intergenic
1143223743 17:5282641-5282663 CGGGCGGAGGCGGGGGCGCGCGG + Intronic
1145243523 17:21253051-21253073 GGAGCCGGGCCGCGGGCGCGCGG + Intronic
1146057751 17:29589584-29589606 CGAGCGGCGGCGGGGCGGCGCGG - Intronic
1146283487 17:31559646-31559668 GCAGGCGCGGCGTGGGAGCGTGG + Intergenic
1146445240 17:32927966-32927988 CGGGCCACCGCGGGGGCGCGAGG + Exonic
1146955859 17:36936116-36936138 GGAGGCGCGGCGCCGGCGCGGGG - Intergenic
1148048718 17:44759086-44759108 GGAGCCGGGGCGGGGGCGCGGGG - Exonic
1148323721 17:46771753-46771775 CGCGGCGCGGCGCGGGGGCGGGG - Intronic
1150239938 17:63622913-63622935 CGGGCCGCGGCGCGCGAGCGGGG - Intronic
1150488918 17:65561354-65561376 CGAGCCGCGGCGTGGGCGCGGGG - Intronic
1150823921 17:68457698-68457720 CCAGCCGTGGCTTGGGCTCGTGG - Intergenic
1152396278 17:80035694-80035716 GGAGCTGGGGCGGGGGCGCGCGG - Intronic
1152708942 17:81860597-81860619 CGCGCCGCGGCCAGCGCGCGCGG - Exonic
1152748425 17:82051657-82051679 CGGGCCGGGGCGGGCGCGCGGGG + Exonic
1152861358 17:82698414-82698436 CGTGCCGGGGTGCGGGCGCGGGG - Intronic
1153052189 18:909448-909470 GGAGCCTCGGCGGCGGCGCGGGG + Exonic
1153480773 18:5543936-5543958 CGCGCCGCGGCGTGGGGACTAGG + Exonic
1154202332 18:12308178-12308200 CGAGCGGCGGGGCGGGGGCGGGG + Exonic
1157095004 18:44679638-44679660 CGGGACGCGGCGGGGGCGCGGGG + Intergenic
1160521558 18:79511016-79511038 CGAGGCCTGGCGTGGGCCCGCGG + Intronic
1160543416 18:79637946-79637968 CGAGGCACGGCCTGGGCCCGGGG + Intergenic
1160631303 18:80247678-80247700 GGAGCTGCAGCGTGGGGGCGTGG - Intergenic
1160930165 19:1566678-1566700 CGAGCTGCGGGGCGGGCGGGCGG - Intronic
1161400898 19:4065920-4065942 CGCGGCGCGGCGCGGGGGCGGGG - Intronic
1162524099 19:11197540-11197562 CGCGCCGCAGCCTGGGCGCCCGG + Exonic
1163159791 19:15457749-15457771 CGAGCAGCGGCGGGGGCACCCGG - Exonic
1163427014 19:17245517-17245539 GGGGCCCCGGCGGGGGCGCGCGG + Exonic
1163466352 19:17470425-17470447 AGAGCCGAGGCCTGGGGGCGCGG + Exonic
1163606934 19:18280861-18280883 CGGGCGGCGCCGGGGGCGCGGGG - Exonic
1163822127 19:19502070-19502092 CGGGCTGCGGTGGGGGCGCGAGG - Intronic
1164648107 19:29873633-29873655 CGAGCGGCCGGGAGGGCGCGGGG - Intergenic
1165173082 19:33906839-33906861 CGAGCTGCTGCGTACGCGCGGGG + Intergenic
1165774293 19:38395724-38395746 CGGGCCGGGGGGTGGGCGAGCGG - Exonic
1165851439 19:38852193-38852215 CGAGCAGCGGGGTGGGGGCGGGG - Intronic
1166546901 19:43639542-43639564 CGAGCGGGGGAGGGGGCGCGGGG - Intronic
1166790688 19:45396773-45396795 CGGGCCGCGGGGAGGGCGCACGG + Exonic
1166938144 19:46347295-46347317 GGAGCTGCAGCCTGGGCGCGGGG + Intronic
1167488284 19:49776190-49776212 CGGGCGGCGGCGGGGGCGGGTGG - Intronic
1167643791 19:50695279-50695301 CGGGCCGCGGCGGTAGCGCGAGG + Intronic
925399051 2:3558613-3558635 CGAACTGCGGCCTGGGGGCGGGG - Exonic
927591295 2:24360303-24360325 GGAGGCGCGGCGAGGGCGCCAGG - Exonic
927633432 2:24793647-24793669 GGGGCCGCGGGATGGGCGCGGGG + Intronic
931868270 2:66434195-66434217 CGCGCCGCGCCCTGGGCGCACGG + Intronic
934049798 2:88200463-88200485 TGAGCCGCTGCGCGGGGGCGGGG + Intergenic
935746575 2:106194348-106194370 CGCGCGGGGGCGGGGGCGCGCGG - Intergenic
936452767 2:112645872-112645894 CGAGGCGCGGCGGGGTCACGCGG + Exonic
936512203 2:113157459-113157481 CCAGCCGGCGCCTGGGCGCGGGG + Intronic
940639638 2:156333026-156333048 CGAGCCGCTGCGCGGGCGCAGGG - Intronic
941095916 2:161239085-161239107 CGCCCCGGGGAGTGGGCGCGCGG - Intergenic
941111765 2:161424239-161424261 CGGGCCGCGGCGGGGCCGGGCGG - Exonic
941119119 2:161507872-161507894 GGAGGCGCGGCCTGGGCCCGCGG - Intronic
942890519 2:180981091-180981113 CGAGCCGCGGCGGGGCCGGCTGG + Intronic
943639600 2:190343860-190343882 GGAGGCGCGGCCCGGGCGCGAGG - Exonic
944451759 2:199850944-199850966 GCAGCAGCGGCGAGGGCGCGGGG + Exonic
946321958 2:218959707-218959729 CTAGCCCCGGCCCGGGCGCGCGG - Exonic
948467497 2:238159237-238159259 CGAGCCGGGGCGTGCGGGCGCGG - Intronic
948645224 2:239400435-239400457 CCCGCCGGGGCGGGGGCGCGGGG - Exonic
948801507 2:240435529-240435551 CGGGGCGCGGCGCGGGGGCGCGG - Intergenic
948963244 2:241356396-241356418 CGTGAAGCGGCCTGGGCGCGTGG + Intronic
1172702949 20:36863737-36863759 CGAGCCGAGGCGGCGGGGCGGGG - Intergenic
1173548022 20:43914455-43914477 CGCCCCGCGGCGTGGGTGCGGGG - Intergenic
1173939060 20:46894750-46894772 CGCGCCGCTGCGTGGGCGCGTGG - Exonic
1174648498 20:52105171-52105193 GGAGCCGCGGCCTGCGCGCCGGG - Intronic
1175340935 20:58228601-58228623 CGGGCGGCGGCGGGGGCGGGCGG - Exonic
1176016639 20:62937457-62937479 CGGGACGCGGCCAGGGCGCGCGG - Intronic
1176281626 20:64316746-64316768 CGGGGCGCGGCGGGGGCGCGGGG + Intergenic
1178707648 21:34888849-34888871 GGCGCGGCGGCGGGGGCGCGCGG - Intronic
1180960532 22:19760582-19760604 CGAGCCGCGGCGGGCGGGCTGGG + Intronic
1181177476 22:21045916-21045938 CGGGCCGCGCTCTGGGCGCGGGG + Intergenic
1181539800 22:23566972-23566994 GGCGCCGCGGCCTGGACGCGTGG + Intergenic
1182289834 22:29268569-29268591 CTTGCTGCGGCGGGGGCGCGCGG + Intronic
1183486182 22:38088885-38088907 CGGGCGGCGGCGGGGGCGCCAGG - Exonic
1184046750 22:41976855-41976877 CGAGCCGAGGCGAGGTCCCGGGG + Exonic
1184276484 22:43411956-43411978 CGGGCGGCGGAGGGGGCGCGGGG + Intronic
1184557430 22:45240908-45240930 CGAGCGGAGCCGGGGGCGCGCGG - Intergenic
1185343129 22:50300326-50300348 CGAGCCGTGGAAGGGGCGCGGGG + Intronic
1185398545 22:50604554-50604576 CGAGGCGCGGCGGGCGCGGGCGG - Exonic
950153842 3:10708044-10708066 CGGGCGGCGGCGGGGCCGCGGGG - Intergenic
954437496 3:50503740-50503762 GTGGCCGCGGCGGGGGCGCGCGG - Intronic
955277016 3:57556392-57556414 CGAAGCGCGGCGCGGGCGCCTGG - Exonic
962222356 3:133574187-133574209 CGGGCGGCGGGGCGGGCGCGGGG + Exonic
962738888 3:138348746-138348768 CGAGCCGGGGCTGGAGCGCGCGG + Intronic
963081931 3:141402497-141402519 CGAGGCGCGGCCTGCGGGCGCGG + Intronic
966743205 3:183253216-183253238 CGGGCCCGGGCGGGGGCGCGAGG - Intronic
967867750 3:194204196-194204218 CGAGACGCGGCCCGGGCCCGGGG + Intergenic
967904290 3:194487570-194487592 GGAGGCGAGGCGCGGGCGCGTGG - Intronic
968186963 3:196639638-196639660 GGAAGCGCGGCGCGGGCGCGGGG - Intergenic
968434068 4:576087-576109 CGGGCGGCGGCGGGCGCGCGGGG - Intergenic
968583021 4:1403635-1403657 CGAGGCGCGGAGGAGGCGCGGGG - Exonic
968701077 4:2058703-2058725 CGAGCCCCGCAGTGGGCACGGGG - Intergenic
968908006 4:3463432-3463454 CGGGGCGCGTCGGGGGCGCGGGG + Intronic
968923076 4:3532593-3532615 CGGGCCGCGGCGTGGTTGCCTGG - Intergenic
969053153 4:4386749-4386771 CGGGCGGCGGCCTGGGCGCGAGG - Exonic
969597832 4:8158896-8158918 CGGGCGGCAGCGGGGGCGCGGGG - Intergenic
971757462 4:30721435-30721457 CGGACCGCGGGATGGGCGCGCGG + Exonic
972396571 4:38663870-38663892 CGAGGCGCGGCGCGGCCGTGGGG - Intergenic
973110265 4:46389927-46389949 GGAGCCGCGGCGGCGGCGCGAGG + Intronic
976276599 4:83284730-83284752 CGAGCCGCGGGGTTCGCGCGGGG - Exonic
979785681 4:124712796-124712818 CGAGCGGCGGGGCGGGGGCGGGG - Intergenic
980130047 4:128809887-128809909 CGGGCCGCGGGGGGCGCGCGGGG + Intronic
985111968 4:186555449-186555471 CGGGATGGGGCGTGGGCGCGGGG - Exonic
985896250 5:2751446-2751468 CGAGCAGCGGGCAGGGCGCGCGG + Exonic
986330523 5:6713665-6713687 CGCGGCGCGGGGCGGGCGCGGGG - Intergenic
997584100 5:135034457-135034479 AGAGGCGCGGCGAGGCCGCGGGG - Intronic
998142837 5:139709716-139709738 AGGGCCCCGGCGTGGGAGCGGGG - Intergenic
998142860 5:139709782-139709804 AGAGCCGGGGCGTGGAGGCGGGG - Intergenic
1001984286 5:176060901-176060923 CGAGCAGCGGTGGGGGCGGGTGG + Intronic
1002123389 5:177022942-177022964 CGAGCCGCGCAGCGGGCGAGGGG - Intronic
1002233190 5:177783164-177783186 CGAGCAGCGGTGGGGGCGGGTGG - Intronic
1002262789 5:178006617-178006639 CGAGCAGCGGTGGGGGCGGGTGG + Intronic
1002541175 5:179907552-179907574 CGCGGCGGGGCGGGGGCGCGAGG - Intronic
1002785031 6:393567-393589 GGAGCCGGGTCCTGGGCGCGTGG + Intronic
1002888150 6:1313370-1313392 CGGGCCGCAGCCCGGGCGCGGGG - Exonic
1004396237 6:15248460-15248482 CGTGCCGGGGAGGGGGCGCGCGG + Intronic
1004850240 6:19691702-19691724 TGGGCCGCGGGCTGGGCGCGCGG + Intergenic
1005912965 6:30326903-30326925 CGCGCCGCGGGGCGGGGGCGAGG + Exonic
1008160406 6:48068917-48068939 CGGGAGGCGGCGAGGGCGCGGGG - Intergenic
1014798241 6:125749414-125749436 CCAGCCGAGGCGTGGGAACGCGG - Intronic
1015149343 6:130020220-130020242 CGCGCCGCGGCGGCGGGGCGGGG + Intronic
1017470556 6:154733803-154733825 CGGGCTGCTGCGTGGCCGCGAGG - Intronic
1017898974 6:158704413-158704435 GGAGCCGCAGCGGGGACGCGGGG + Intronic
1019474636 7:1238194-1238216 CGGGCAGGGGCGGGGGCGCGGGG - Intergenic
1020238468 7:6374469-6374491 GGAGCGGCGGCGCCGGCGCGGGG + Intergenic
1021653656 7:22854369-22854391 CGAGCCGAGGCCTCGGCGTGGGG - Intergenic
1022427927 7:30285461-30285483 CGGGCGGCGGCGGGGGCGCTCGG + Exonic
1023064787 7:36366876-36366898 CTGGCCGCGGCGGGGGTGCGGGG - Intronic
1024394276 7:48848124-48848146 CGAGCCTCGGCGGGCGCGCGCGG - Intergenic
1024580044 7:50793618-50793640 GGAGCCGGGGCCTGGGCGCAGGG + Intergenic
1026025598 7:66741253-66741275 CCGGCCGCGGCAGGGGCGCGGGG + Intronic
1026806823 7:73434091-73434113 CGACCCGGAGCGCGGGCGCGGGG + Exonic
1026837486 7:73648173-73648195 CCAGCCGCGGGCTGGGCTCGGGG + Intergenic
1027152065 7:75739590-75739612 CGGGGCGCAGCGTGGGCGCCTGG + Intergenic
1027244477 7:76358338-76358360 CTAGCCTGGGCGTGGGGGCGGGG - Intronic
1031011173 7:116526199-116526221 TGAGCCGGGGCGTGCGCGGGCGG + Intronic
1031043549 7:116862918-116862940 CGGGCGGGGGCGCGGGCGCGGGG + Intronic
1032344359 7:131105945-131105967 CGGGCGGCGGCGGGCGCGCGCGG + Intergenic
1033654357 7:143362795-143362817 CGAGCCGGGGCGGGGGAGCCAGG - Intergenic
1034223060 7:149460357-149460379 CGAGCGGCGGCGTCGGAGCTGGG + Intronic
1034435099 7:151059659-151059681 CGCGCCCCGGGGTGGGCACGGGG + Intronic
1034509268 7:151520613-151520635 CGGGCCGCGGTGTGGACGGGCGG + Intergenic
1035021681 7:155804268-155804290 CGCGCCTCGGCGTGGGCCTGCGG + Intronic
1035168482 7:157005372-157005394 CCAGCCCCGGCCTGGGCGAGGGG + Exonic
1035168596 7:157005763-157005785 AGGGCGGCGGCGGGGGCGCGGGG - Exonic
1037450644 8:19013531-19013553 GGGGCCGGGGCGCGGGCGCGGGG - Intronic
1037826777 8:22164788-22164810 CGACCCGAGGCGGGGGCGCGGGG + Exonic
1041281073 8:56211531-56211553 CGGGCCGCGGCTGGGGGGCGCGG + Intergenic
1041690087 8:60679360-60679382 CCGGCGGCGGCGGGGGCGCGCGG + Intronic
1049620941 8:143598014-143598036 GGGGCCGCGGCCCGGGCGCGGGG - Exonic
1050357061 9:4793243-4793265 CGGCGCGCGGCGTGGGCGCGGGG + Intronic
1053003386 9:34589918-34589940 CGTGCCAAGGCGGGGGCGCGCGG - Intronic
1054731390 9:68705506-68705528 CGCGCCTTGGCGGGGGCGCGCGG - Intronic
1056991953 9:91421342-91421364 GGAGGCGCCGCGTGGGGGCGCGG - Intronic
1056992267 9:91423493-91423515 CCAGCGGCGGCGAGTGCGCGCGG - Intronic
1057146938 9:92764848-92764870 CGTGCGGCGGCGCGGGCGGGCGG - Intergenic
1057546295 9:96021989-96022011 CGACCTGCGGGGTGGGCGTGAGG - Intergenic
1057758352 9:97854021-97854043 CGGGCCGCGGGGCGGGCGGGCGG + Exonic
1057921881 9:99104847-99104869 CGAGAGGCCGCGTGGGGGCGGGG - Intronic
1059375132 9:113875893-113875915 GGAGCCGGGGAGCGGGCGCGGGG + Intergenic
1059470930 9:114504709-114504731 CGGGCGGCGGCGGGGGCGCGGGG - Exonic
1060478006 9:123999885-123999907 GGAGCCGAGGACTGGGCGCGCGG - Intergenic
1060811656 9:126614040-126614062 CGGGCCGCGGGGGGGGCGCGCGG - Intergenic
1061207837 9:129174790-129174812 GGAGCCGCGGCTTGGGCCCAGGG - Intergenic
1061261399 9:129482709-129482731 GCCGCCGCGGCGTGGGGGCGGGG + Intergenic
1061382293 9:130265754-130265776 CGGGCCGCGGCCAGTGCGCGAGG - Intergenic
1061975708 9:134067352-134067374 CGCGCCGCGGCCGGGGCGGGGGG - Intronic
1062472456 9:136712487-136712509 GGCGGCGCGGCGGGGGCGCGCGG - Intergenic
1062476021 9:136727972-136727994 CGAGCCGCGGGATGGGGGCCCGG - Intergenic
1062507618 9:136886226-136886248 CGCGCCGGGGCGTTGGTGCGGGG - Intronic
1062529039 9:136991979-136992001 GGAGCCGGGGCGGGGGCGGGAGG + Intergenic
1186410755 X:9342759-9342781 CGGCCGGCGGCGTGGGGGCGGGG - Intergenic
1187067299 X:15854211-15854233 TCAGCCGCGGCGCGGGCTCGGGG + Intronic
1187698033 X:21940661-21940683 CGACCCGGGGCGCGGGGGCGGGG - Exonic
1187915731 X:24150376-24150398 GGCGCGGCGGCGTGTGCGCGCGG + Intronic
1190688876 X:52897354-52897376 CGAGGCGCCGCGTTGGCGCTTGG + Intronic
1190697107 X:52958438-52958460 CGAGGCGCCGCGTTGGCGCTTGG - Exonic
1192630952 X:72777480-72777502 CGGGGGGCGGCGGGGGCGCGGGG - Intronic
1192650757 X:72943321-72943343 CGGGGGGCGGCGGGGGCGCGGGG + Intronic
1197709360 X:129654710-129654732 CGAGCCGCGGCTGGCGCGTGCGG + Exonic