ID: 1150488919

View in Genome Browser
Species Human (GRCh38)
Location 17:65561355-65561377
Sequence CCGAGCCGCGGCGTGGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 260}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150488919_1150488930 5 Left 1150488919 17:65561355-65561377 CCCGCGCCCACGCCGCGGCTCGG 0: 1
1: 0
2: 2
3: 19
4: 260
Right 1150488930 17:65561383-65561405 CCTCGCCCCCTGTAAGAGGGGGG 0: 1
1: 0
2: 0
3: 3
4: 88
1150488919_1150488926 2 Left 1150488919 17:65561355-65561377 CCCGCGCCCACGCCGCGGCTCGG 0: 1
1: 0
2: 2
3: 19
4: 260
Right 1150488926 17:65561380-65561402 CGACCTCGCCCCCTGTAAGAGGG 0: 1
1: 0
2: 0
3: 3
4: 32
1150488919_1150488936 29 Left 1150488919 17:65561355-65561377 CCCGCGCCCACGCCGCGGCTCGG 0: 1
1: 0
2: 2
3: 19
4: 260
Right 1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 59
1150488919_1150488937 30 Left 1150488919 17:65561355-65561377 CCCGCGCCCACGCCGCGGCTCGG 0: 1
1: 0
2: 2
3: 19
4: 260
Right 1150488937 17:65561408-65561430 TTCTTTGAAGCGGCTCCGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 36
1150488919_1150488927 3 Left 1150488919 17:65561355-65561377 CCCGCGCCCACGCCGCGGCTCGG 0: 1
1: 0
2: 2
3: 19
4: 260
Right 1150488927 17:65561381-65561403 GACCTCGCCCCCTGTAAGAGGGG 0: 1
1: 0
2: 0
3: 3
4: 33
1150488919_1150488935 20 Left 1150488919 17:65561355-65561377 CCCGCGCCCACGCCGCGGCTCGG 0: 1
1: 0
2: 2
3: 19
4: 260
Right 1150488935 17:65561398-65561420 GAGGGGGGCTTTCTTTGAAGCGG 0: 1
1: 0
2: 1
3: 13
4: 153
1150488919_1150488928 4 Left 1150488919 17:65561355-65561377 CCCGCGCCCACGCCGCGGCTCGG 0: 1
1: 0
2: 2
3: 19
4: 260
Right 1150488928 17:65561382-65561404 ACCTCGCCCCCTGTAAGAGGGGG 0: 1
1: 0
2: 1
3: 2
4: 81
1150488919_1150488925 1 Left 1150488919 17:65561355-65561377 CCCGCGCCCACGCCGCGGCTCGG 0: 1
1: 0
2: 2
3: 19
4: 260
Right 1150488925 17:65561379-65561401 GCGACCTCGCCCCCTGTAAGAGG 0: 1
1: 0
2: 0
3: 2
4: 21

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150488919 Original CRISPR CCGAGCCGCGGCGTGGGCGC GGG (reversed) Intronic
900408906 1:2504134-2504156 CCGTGCAACGGCGAGGGCGCCGG + Exonic
900513125 1:3069582-3069604 CCGAGGCGCGCGGTGGGGGCCGG + Intronic
901425952 1:9182561-9182583 CCCAGCGGCGGCGTGGGCGAGGG - Intergenic
901525867 1:9823420-9823442 CGGAGCCGGGGCCAGGGCGCAGG - Intronic
902246514 1:15124474-15124496 CCGGGCCGCGCCTGGGGCGCAGG - Intergenic
903190170 1:21651909-21651931 CCGAGCTGGGGCGGGGGCGGGGG - Intronic
903455431 1:23484010-23484032 CCGAGGGGCGGCGCTGGCGCGGG - Exonic
904585434 1:31577213-31577235 CCCAGCAGGGTCGTGGGCGCCGG + Exonic
904751068 1:32741774-32741796 CCGAGCGGCGGGCGGGGCGCAGG - Intergenic
905639000 1:39576033-39576055 GTGAGCCGCGGCGCGGGCCCGGG - Exonic
905912126 1:41662299-41662321 ACGCGGCGCGGGGTGGGCGCGGG + Intronic
910981241 1:92961544-92961566 GCGCGCCGCGGCGGGGGCGGGGG - Intergenic
919403259 1:197146471-197146493 CGGAGCCGCCTCGTGGGAGCGGG - Exonic
922676776 1:227558459-227558481 CCGGGCTGCAGCGGGGGCGCAGG - Intergenic
922730700 1:227947673-227947695 CCGGGGCGCGGCGGGGCCGCCGG - Intronic
922739341 1:228006815-228006837 CCGAACCGCGGCGGCGGCGTTGG - Intergenic
922958621 1:229626016-229626038 CAGAGCGGCGGCGGGGGCGGCGG - Exonic
923055921 1:230425989-230426011 GCGGGCCGCGGCGCGGGCCCAGG - Intergenic
1063114824 10:3066581-3066603 CGGCGCCCCGGCCTGGGCGCTGG - Intronic
1063115418 10:3068522-3068544 CGGCGCCGCGGCGCGGGCTCCGG + Intronic
1065100405 10:22325650-22325672 CCGAGCCTCGGCGGGCGTGCGGG - Intronic
1066406960 10:35127306-35127328 CCGAGCGGAGCCGTGGGCGGCGG + Intronic
1073287972 10:102399742-102399764 ACGAGGCGCGGGGTGGGGGCAGG + Intronic
1073325545 10:102642596-102642618 CCGGGCCGTGGCGGGGGCCCCGG + Intergenic
1073325900 10:102643944-102643966 CCGGGGCGCTGCGTGCGCGCAGG - Intergenic
1074169734 10:110920000-110920022 GCGAGCCGGCGCGAGGGCGCGGG + Intronic
1074503342 10:114044973-114044995 CCGGGCGGCGGCGCGGGCGCGGG - Exonic
1075401300 10:122163381-122163403 ACGAGCCGCGGCCCGGGAGCTGG - Intronic
1075616129 10:123891858-123891880 CAGAGGCGCGGGGCGGGCGCAGG + Intronic
1075741800 10:124700523-124700545 CCCTGCCCCGGCGTGGGCTCGGG - Intronic
1075999825 10:126905684-126905706 CGGGGCGGCGGCGCGGGCGCGGG - Intronic
1076035532 10:127196221-127196243 GCGAGCTGCGGCGCGGGGGCCGG - Intronic
1076138050 10:128058463-128058485 CCGGGCAGCTGCGTGGGCCCTGG - Intronic
1076394550 10:130129197-130129219 CCTGGGTGCGGCGTGGGCGCGGG - Intergenic
1077044302 11:537675-537697 CTGCGCCGAGGCGTGGGCGCGGG + Intronic
1077330748 11:1982853-1982875 CCGAGCAGCGGCGTTAGGGCTGG + Intronic
1078180187 11:9004405-9004427 CCGAGCAGCGGCGCGGGCGGCGG - Intergenic
1078233318 11:9461514-9461536 CCAGGCCGCAGCGGGGGCGCCGG + Intronic
1079642995 11:22829893-22829915 CAGAGCTGCGGGGTGGGGGCGGG - Intronic
1084175604 11:67420799-67420821 CCGAGCAGCGCGGCGGGCGCCGG + Exonic
1084652564 11:70497791-70497813 CCCAGCCTCGGCATGGACGCTGG - Intronic
1086590528 11:88509340-88509362 GAGAGCCGTGGCCTGGGCGCTGG - Exonic
1087175314 11:95090244-95090266 CCGAGCCGGGCTGCGGGCGCCGG + Intronic
1088401063 11:109422945-109422967 CCGGGCCGCCGCGCGGGCTCCGG - Intronic
1089078857 11:115760102-115760124 ATGACCCGCGGCGGGGGCGCTGG - Intergenic
1091243409 11:134069661-134069683 GGCAGCTGCGGCGTGGGCGCTGG + Intronic
1091266623 11:134276573-134276595 CCGTCCCGAGGCGCGGGCGCCGG - Intronic
1202813728 11_KI270721v1_random:38032-38054 CCGAGCAGCGGCGTTAGGGCTGG + Intergenic
1096159831 12:49367319-49367341 GCGAGCCGCTGCCTGGGCGAGGG + Intronic
1096241365 12:49961877-49961899 GCCAGCCTCGGAGTGGGCGCGGG + Exonic
1096459467 12:51814332-51814354 CCGCGGCGCGCCGGGGGCGCGGG + Intergenic
1096461077 12:51821686-51821708 GCGGGCAGGGGCGTGGGCGCGGG + Intergenic
1097195465 12:57240339-57240361 CCAAGGCGCGGTGGGGGCGCCGG - Intronic
1101371845 12:104137933-104137955 CCGGGCCGGGGAGCGGGCGCGGG - Intronic
1103764104 12:123269727-123269749 CCAAGCCGCGGCCTGGCCGGTGG - Intronic
1104930529 12:132337151-132337173 CAGAGCCACGGCCGGGGCGCAGG - Intergenic
1105578629 13:21674460-21674482 CGGAGCGGAGGCGGGGGCGCGGG - Intronic
1105964413 13:25371960-25371982 CCGGGCTGCGGCGTGGGGGCGGG - Intergenic
1106340264 13:28820311-28820333 CGCAGCCGCGGCGCGGGCGTGGG + Intergenic
1107078205 13:36346271-36346293 CCGTGCCGCGGCGGCCGCGCAGG - Intronic
1107133330 13:36919691-36919713 TCGACCCGCGGCGGGGGCGGCGG - Intronic
1112506994 13:99981408-99981430 CCTGACCGCGGCGGGGGCGCCGG - Intergenic
1112761120 13:102694457-102694479 CCGCGCAGCAGCCTGGGCGCCGG - Exonic
1114073411 14:19132787-19132809 CTGAGAGGCGGCCTGGGCGCCGG - Intergenic
1114088855 14:19267196-19267218 CTGAGAGGCGGCCTGGGCGCCGG + Intergenic
1122445084 14:101761995-101762017 CTGAGCCGGGGCCCGGGCGCAGG - Intronic
1122888996 14:104724083-104724105 CCGGGCAGCGGCGAGGGGGCGGG + Intergenic
1122975411 14:105168834-105168856 CCGCGCCGCGGGGTGGGGCCGGG + Intergenic
1123037994 14:105479080-105479102 CCGAGCCCCGGGGCGGGGGCGGG - Intronic
1126109480 15:45167144-45167166 CCCAGCCGGGGCGGGGGCGGCGG + Intergenic
1128547720 15:68579136-68579158 CCGAGCCGCCGGCGGGGCGCGGG + Exonic
1128758832 15:70201092-70201114 CCGAGCCTGGGCCTGGGCGAGGG + Intergenic
1129189134 15:73927405-73927427 GCGGGCGGCGGCGTGGGCGCGGG + Exonic
1129273871 15:74433207-74433229 CCGGGCCGGGGCGGGGGCGGGGG + Intronic
1130540392 15:84817471-84817493 CCCAGCCGGGGCTGGGGCGCGGG + Exonic
1132480679 16:164901-164923 CCGGGCCGGGGCGGGGTCGCGGG + Intronic
1132527981 16:426733-426755 CCGGGCCGGGGCGTGGGAACTGG + Intronic
1132641874 16:981775-981797 CCGAGCCTCGGCGGCGGCGGCGG + Intergenic
1132730064 16:1356746-1356768 CCCAGGAGGGGCGTGGGCGCCGG - Intronic
1132779334 16:1614282-1614304 GGGAGCCCCGGCGCGGGCGCGGG - Intronic
1133188436 16:4116299-4116321 GCGGCCCCCGGCGTGGGCGCGGG - Intergenic
1137054119 16:35735319-35735341 CCTAGCCGCGGCATGGGCGCAGG - Intergenic
1137054253 16:35735822-35735844 CTGGGCCGCGGCAGGGGCGCAGG - Intergenic
1137056618 16:35749246-35749268 CCGGGCCGCGGTGGGGGCACAGG - Intergenic
1137988715 16:53131319-53131341 CCGAGCAGCGGCGGCGGCGGCGG - Intronic
1142187928 16:88703320-88703342 CCGAGCCCCGGCCTGGTCTCTGG - Intronic
1142476761 17:193510-193532 CCGAGCAGGGGCGTGGTGGCTGG - Intergenic
1143099877 17:4499109-4499131 CGGAGCGGCGGCGCCGGCGCCGG + Exonic
1143125649 17:4639704-4639726 CCGAGGAAGGGCGTGGGCGCTGG - Intronic
1143402828 17:6657119-6657141 CCGAGGAAGGGCGTGGGCGCTGG + Intergenic
1144109806 17:12020902-12020924 CCGAGCGGCGGCGGCGGCTCCGG + Exonic
1144328958 17:14207175-14207197 CCGAGCGGAGGCGGGGACGCAGG + Exonic
1145388471 17:22435803-22435825 CCGAGCCCCGGCGAGCTCGCGGG + Intergenic
1146008412 17:29176826-29176848 CCGCGCGGCGGCGTGAGGGCTGG - Intronic
1146763484 17:35498063-35498085 CAGAGCGGCGGCGAGGGCGGCGG + Intronic
1146955860 17:36936117-36936139 CGGAGGCGCGGCGCCGGCGCGGG - Intergenic
1146957226 17:36942726-36942748 CGGAGCGGCGGGGAGGGCGCAGG - Intronic
1148048719 17:44759087-44759109 CGGAGCCGGGGCGGGGGCGCGGG - Exonic
1148271761 17:46267014-46267036 CTGAGGCGCGGCGGCGGCGCGGG - Intergenic
1150239939 17:63622914-63622936 CCGGGCCGCGGCGCGCGAGCGGG - Intronic
1150488919 17:65561355-65561377 CCGAGCCGCGGCGTGGGCGCGGG - Intronic
1150692379 17:67377492-67377514 CCGAGCGGCGGCGGCGGCGGCGG + Intronic
1152361055 17:79833039-79833061 GCGGGCCGCGGCGCCGGCGCAGG - Intergenic
1152737275 17:82003759-82003781 CTGTGCCAGGGCGTGGGCGCGGG - Intronic
1152748424 17:82051656-82051678 CCGGGCCGGGGCGGGCGCGCGGG + Exonic
1157095003 18:44679637-44679659 ACGGGACGCGGCGGGGGCGCGGG + Intergenic
1159436074 18:68419015-68419037 CAGAGCCTCAGCCTGGGCGCCGG - Intergenic
1159798455 18:72869082-72869104 CCCAGCCGCGGCGCGGGTGTGGG - Intergenic
1160543415 18:79637945-79637967 CCGAGGCACGGCCTGGGCCCGGG + Intergenic
1160791550 19:925885-925907 CAGCGCCGCGGCCCGGGCGCGGG - Intronic
1160921800 19:1524146-1524168 CCCGGCCGCGGCGGCGGCGCAGG + Intronic
1160992205 19:1864414-1864436 CCGGGCCCCGCCGCGGGCGCGGG - Intergenic
1162457896 19:10796835-10796857 CAGGCCCGCGGCGTTGGCGCGGG - Intronic
1164977016 19:32581115-32581137 CCGCGCCGCTGCCAGGGCGCCGG - Exonic
1165173081 19:33906838-33906860 CCGAGCTGCTGCGTACGCGCGGG + Intergenic
1165204528 19:34172466-34172488 CCGCGCCGCGGCTTGAGGGCGGG + Intergenic
1165236797 19:34428398-34428420 ACGAGCCGCGGCGGAGGCGGAGG - Exonic
1165349388 19:35268097-35268119 CCGGCCGGCGGCGCGGGCGCGGG - Intergenic
1165851440 19:38852194-38852216 CCGAGCAGCGGGGTGGGGGCGGG - Intronic
1166734368 19:45075712-45075734 CCCAGCCGCGGCCAGGGCTCAGG - Exonic
1166938143 19:46347294-46347316 CGGAGCTGCAGCCTGGGCGCGGG + Intronic
1168081238 19:54012067-54012089 CTGGGCTGCGGCGTGGGGGCCGG + Exonic
925399052 2:3558614-3558636 CCGAACTGCGGCCTGGGGGCGGG - Exonic
926116470 2:10216898-10216920 GCGGGCCGAGGCGTGGGCCCTGG + Intergenic
927216624 2:20671063-20671085 CAGGGCAGCGGCGGGGGCGCGGG + Exonic
927633431 2:24793646-24793668 CGGGGCCGCGGGATGGGCGCGGG + Intronic
927843374 2:26458889-26458911 CAGAGCCGGGGCTTGGGTGCAGG + Intronic
927965460 2:27264983-27265005 CCGAGCCGCGGAGTGCGCGGTGG - Intronic
929966816 2:46542763-46542785 CCGGGCCGGGGAGAGGGCGCGGG + Exonic
932422755 2:71611356-71611378 CCGGGCCTGGGCGTGGGGGCTGG + Intronic
933772823 2:85754730-85754752 CCGGGGCGCGTCGGGGGCGCAGG - Exonic
934049797 2:88200462-88200484 CTGAGCCGCTGCGCGGGGGCGGG + Intergenic
934933278 2:98445336-98445358 CCGAGCGGGCGCGTGGCCGCGGG + Intronic
936433268 2:112482241-112482263 CCGGGCCGCGGCGGGCGCCCGGG + Exonic
936439956 2:112542688-112542710 CCTCGCCGCGGCAAGGGCGCCGG - Intronic
936512201 2:113157458-113157480 CCCAGCCGGCGCCTGGGCGCGGG + Intronic
940639639 2:156333027-156333049 CCGAGCCGCTGCGCGGGCGCAGG - Intronic
944451758 2:199850943-199850965 CGCAGCAGCGGCGAGGGCGCGGG + Exonic
946395567 2:219442205-219442227 CCGAGCCCCGCCGAGGGCGGCGG + Intronic
947117987 2:226791808-226791830 CCGGGCCGCGTGGTCGGCGCTGG - Intronic
1169496721 20:6122851-6122873 CCGAGCCGAGGAGCGGGCGCTGG + Exonic
1172702950 20:36863738-36863760 CCGAGCCGAGGCGGCGGGGCGGG - Intergenic
1173548023 20:43914456-43914478 CCGCCCCGCGGCGTGGGTGCGGG - Intergenic
1174358334 20:50012871-50012893 CAGAGCCGGGGCCTGGGAGCTGG + Intergenic
1174648499 20:52105172-52105194 AGGAGCCGCGGCCTGCGCGCCGG - Intronic
1175847369 20:62065824-62065846 CCGAGCGGCGGCGGCGGCGGCGG - Intergenic
1175997159 20:62817029-62817051 CTGAGCTGCGGCGTCGGGGCGGG - Intronic
1176099775 20:63359659-63359681 CCGCTCCTCGGCGTGGGCCCGGG + Exonic
1176194433 20:63830900-63830922 CCCAGCTGCGGCGCGGGCTCCGG - Intronic
1176207217 20:63895494-63895516 CTGGGCCGGGGCGGGGGCGCGGG + Intronic
1176281625 20:64316745-64316767 GCGGGGCGCGGCGGGGGCGCGGG + Intergenic
1176548378 21:8211571-8211593 CCGCGACGCGGCGCGTGCGCGGG + Intergenic
1176556270 21:8255777-8255799 CCGCGACGCGGCGCGTGCGCGGG + Intergenic
1176567309 21:8394606-8394628 CCGCGACGCGGCGCGTGCGCGGG + Intergenic
1176575209 21:8438819-8438841 CCGCGACGCGGCGCGTGCGCGGG + Intergenic
1179465388 21:41568299-41568321 CTGAGCCGCGGCGAAGTCGCGGG - Intergenic
1179640610 21:42745220-42745242 CCTGGCCTCGGGGTGGGCGCAGG + Intronic
1180491853 22:15855140-15855162 CTGAGAGGCGGCCTGGGCGCCGG - Intergenic
1180951934 22:19724388-19724410 CCGGGCTGCGGCGCGAGCGCGGG - Exonic
1180960531 22:19760581-19760603 GCGAGCCGCGGCGGGCGGGCTGG + Intronic
1181177475 22:21045915-21045937 CCGGGCCGCGCTCTGGGCGCGGG + Intergenic
1182586322 22:31346092-31346114 GCGAGCCGGGGCGGGGGCGCCGG + Exonic
1183720131 22:39557771-39557793 CCGGGCCGGGGCGGGGGCGCGGG - Intergenic
1184086899 22:42270692-42270714 CCGGGCCGCGGCGCGCGGGCGGG + Intronic
1184332232 22:43834269-43834291 CAGGGCCGCGGTGTGGGTGCGGG - Intronic
1184332249 22:43834325-43834347 CAGGGCCGCGGTGGGGGCGCGGG - Intronic
1184332259 22:43834353-43834375 CAGGGCCGCGGTGGGGGCGCGGG - Intronic
1184332294 22:43834465-43834487 CAGGGCCGCGGTGGGGGCGCGGG - Intronic
1184332348 22:43834633-43834655 CAGGGCCGCGGTGGGGGCGCGGG - Intronic
1184332358 22:43834661-43834683 CAGGGCCGCGGTGGGGGCGCGGG - Intronic
1184332393 22:43834773-43834795 CAGGGCCGCGGTGGGGGCGCGGG - Intronic
1184332437 22:43834913-43834935 CAGGGCCGCGGTGGGGGCGCGGG - Intronic
1184332447 22:43834941-43834963 CAGGGCCGCGGTGGGGGCGCGGG - Intronic
1184332466 22:43834997-43835019 CAGGGCCGCGGTGTGGGTGCGGG - Intronic
1184332483 22:43835053-43835075 CAGGGCCGCGGTGGGGGCGCGGG - Intronic
1184523542 22:45009055-45009077 GCGAGCGGCGGCGTGGCGGCCGG - Intronic
1185271019 22:49929380-49929402 CAGGGCCGAGGCGAGGGCGCAGG + Intergenic
1185317715 22:50186088-50186110 CCGAGTCGGGGGGTGGGGGCCGG + Intronic
1185343128 22:50300325-50300347 CCGAGCCGTGGAAGGGGCGCGGG + Intronic
1185351815 22:50343476-50343498 CCGAGCGGAGGCCAGGGCGCTGG - Exonic
1203253258 22_KI270733v1_random:127874-127896 CCGCGACGCGGCGCGTGCGCGGG + Intergenic
1203261313 22_KI270733v1_random:172955-172977 CCGCGACGCGGCGCGTGCGCGGG + Intergenic
950065494 3:10108336-10108358 CCGAGCCGCGGCGGGGATGGGGG + Intergenic
952301355 3:32106834-32106856 CCATGCTGCGGCGTGGGCACCGG + Intronic
954294780 3:49668172-49668194 CCGAAAAGCAGCGTGGGCGCCGG + Exonic
954401579 3:50322157-50322179 CTGGGTCGCGGCGTGGCCGCAGG + Exonic
954553312 3:51499785-51499807 CCGGGCGGCAGAGTGGGCGCCGG - Intronic
957084826 3:75669466-75669488 CCACGCCCCGGTGTGGGCGCAGG - Intergenic
959530732 3:107431540-107431562 CCGAGCCCCGGCGGCGGCGGCGG - Intergenic
961539349 3:127589722-127589744 CCCAGACGCGGCTCGGGCGCTGG - Intronic
962134740 3:132722156-132722178 CTGCCCCGCGGGGTGGGCGCGGG - Exonic
967762484 3:193241297-193241319 CAGAGCCGCGGAGGGGCCGCCGG + Exonic
967867749 3:194204195-194204217 CCGAGACGCGGCCCGGGCCCGGG + Intergenic
968225616 3:196970121-196970143 CCGACCCTCGGCGGCGGCGCGGG - Intergenic
968443739 4:637631-637653 AGGAGCCGCGGCCTGGGGGCCGG + Intronic
968514393 4:1010202-1010224 CAGGGCCGCGGCGGCGGCGCAGG + Intronic
968701078 4:2058704-2058726 CCGAGCCCCGCAGTGGGCACGGG - Intergenic
969597833 4:8158897-8158919 CCGGGCGGCAGCGGGGGCGCGGG - Intergenic
975870771 4:78776358-78776380 CGGAGCCGCGGAGCGGGCGGCGG + Exonic
976276600 4:83284731-83284753 GCGAGCCGCGGGGTTCGCGCGGG - Exonic
979624257 4:122827525-122827547 CCGGGCTGCGGCGTAGGCCCGGG + Intronic
979785682 4:124712797-124712819 CCGAGCGGCGGGGCGGGGGCGGG - Intergenic
983938093 4:173517082-173517104 CCAAGTGGCGGCCTGGGCGCCGG - Intergenic
984734860 4:183099386-183099408 CCAACCCGCGACGCGGGCGCCGG - Exonic
984888662 4:184473285-184473307 CCGAGCGGCGCAGTGGGGGCCGG - Intronic
985006012 4:185535666-185535688 CCGGGCCGCGGCGGGCGCGGGGG + Intergenic
985696681 5:1344901-1344923 CGGAGCGGCGGGCTGGGCGCCGG - Exonic
989576459 5:42992664-42992686 CCGGGCGGCGGCGGCGGCGCTGG + Intergenic
990825431 5:59893357-59893379 CCGGGCGGCGGCGGGGGCGGCGG + Exonic
995224705 5:109689786-109689808 CCCAGCCGCAGCGTCGGCGGCGG + Exonic
998119002 5:139561242-139561264 CCGAGCCGCGCCGGCGGCGGAGG - Exonic
998142838 5:139709717-139709739 CAGGGCCCCGGCGTGGGAGCGGG - Intergenic
998142861 5:139709783-139709805 CAGAGCCGGGGCGTGGAGGCGGG - Intergenic
998267008 5:140673778-140673800 CCAAGCCGCAGGGTGGACGCTGG + Exonic
1001381575 5:171309636-171309658 CCGGGCAGCGGCCTGTGCGCCGG - Exonic
1001401891 5:171450943-171450965 GCGGGCCGCGGCGTGGGCACGGG - Intronic
1002926768 6:1609687-1609709 CCGGGCGCCGGCGCGGGCGCAGG + Intergenic
1004396364 6:15248881-15248903 CCGGGCTGCGGCGTGGGAGGAGG + Intronic
1006547517 6:34792147-34792169 CCTCGCCGCGGCGTGAGCACCGG - Exonic
1007589815 6:43014318-43014340 CCGAGCCGGGGCGGGGCCGCGGG - Exonic
1007633430 6:43285044-43285066 CCTGGCCGCGGCCTGGGCCCAGG + Exonic
1008276795 6:49551457-49551479 CCTCCCCGCGGCGTGGACGCGGG - Exonic
1009431863 6:63573357-63573379 CGGAGCTCCGGGGTGGGCGCGGG + Intronic
1010032897 6:71288841-71288863 CATGGCCGCGGCGAGGGCGCTGG - Exonic
1011553880 6:88554822-88554844 CAGAGCCGCCTCGTGGGCCCTGG - Intergenic
1012939610 6:105402965-105402987 GCGAGGCGCGGCTGGGGCGCAGG + Exonic
1013272470 6:108557747-108557769 CCGAGCCGCGGCGGAGACGACGG - Intergenic
1014230347 6:118895194-118895216 CCGCGCCGCGGGCTGGGCGCCGG + Intronic
1016714097 6:147204076-147204098 GCGAGCAGCGGCGCGGCCGCGGG + Intergenic
1017206461 6:151808368-151808390 CCGACGGGCGGCGCGGGCGCGGG - Intronic
1017738122 6:157381640-157381662 CCGAGGCGCGGCCGGGGAGCCGG + Exonic
1019472705 7:1229844-1229866 CCGAGCCGAGGCGGGCGCGGAGG + Intergenic
1019687167 7:2388359-2388381 CCGGGCCGGGGGGTGGGTGCAGG + Intergenic
1020130165 7:5555206-5555228 CCGAGGGGCGGGGTGGGGGCCGG - Intronic
1021653657 7:22854370-22854392 CCGAGCCGAGGCCTCGGCGTGGG - Intergenic
1023703057 7:42911769-42911791 CTGAGCCGCGGCGCTGGCGGTGG - Intronic
1023842438 7:44104843-44104865 CGGACCCGCGGGGTGGGCTCGGG - Exonic
1024580043 7:50793617-50793639 AGGAGCCGGGGCCTGGGCGCAGG + Intergenic
1025917056 7:65873749-65873771 CCGCCCCGCGGCCTGGGCTCAGG - Intronic
1026004695 7:66591770-66591792 CCCGGCCGCGGCAGGGGCGCCGG - Intergenic
1026025596 7:66741252-66741274 CCCGGCCGCGGCAGGGGCGCGGG + Intronic
1026837484 7:73648172-73648194 CCCAGCCGCGGGCTGGGCTCGGG + Intergenic
1027244478 7:76358339-76358361 CCTAGCCTGGGCGTGGGGGCGGG - Intronic
1031051884 7:116953441-116953463 CCGGGCCGCGGCGGCGGCGGCGG + Exonic
1034223059 7:149460356-149460378 CCGAGCGGCGGCGTCGGAGCTGG + Intronic
1034943384 7:155246602-155246624 CAAAGCCTCGGCGTGGGCGATGG - Intergenic
1037450645 8:19013532-19013554 CGGGGCCGGGGCGCGGGCGCGGG - Intronic
1037826776 8:22164787-22164809 CCGACCCGAGGCGGGGGCGCGGG + Exonic
1037865641 8:22440727-22440749 CGGAGCCGCTGCGAGGCCGCAGG + Intergenic
1039476563 8:37841953-37841975 CGGGGGCGCGGCGGGGGCGCTGG + Exonic
1041244841 8:55880117-55880139 GCGAGCCCAGGGGTGGGCGCGGG + Intronic
1041919856 8:63169043-63169065 CCGGGCCGGGGCGTGCGCCCTGG + Intronic
1045737922 8:105318458-105318480 CGGAGCGGCGGCGGCGGCGCCGG + Intronic
1049334580 8:142076403-142076425 CCGAGCCGCAGCATGAGCTCAGG - Intergenic
1049605717 8:143528342-143528364 CCTGGCCGAGGCGTGGCCGCTGG - Intronic
1049620942 8:143598015-143598037 CGGGGCCGCGGCCCGGGCGCGGG - Exonic
1050357060 9:4793242-4793264 GCGGCGCGCGGCGTGGGCGCGGG + Intronic
1053034112 9:34810024-34810046 CCGAGTTGAGGCGTGGGCGGCGG - Intergenic
1053306143 9:36986086-36986108 GCGCGCCGGGGCGAGGGCGCCGG - Intronic
1057921882 9:99104848-99104870 CCGAGAGGCCGCGTGGGGGCGGG - Intronic
1059021312 9:110579568-110579590 CCGAGCCGCCGCCTGCGCTCCGG - Exonic
1059470931 9:114504710-114504732 GCGGGCGGCGGCGGGGGCGCGGG - Exonic
1061178474 9:129010841-129010863 CCGAGGCCCGGCATGGGAGCTGG + Intronic
1061207838 9:129174791-129174813 TGGAGCCGCGGCTTGGGCCCAGG - Intergenic
1061261398 9:129482708-129482730 CGCCGCCGCGGCGTGGGGGCGGG + Intergenic
1061366297 9:130173705-130173727 CCGGGCAGCTGCGTGGGCCCAGG + Intronic
1061881918 9:133573001-133573023 CCGAGCCAGGGGGTGGGGGCTGG - Intronic
1061987091 9:134136175-134136197 CCGGGCCGCGGCGGCGGGGCCGG - Exonic
1062022580 9:134326397-134326419 GCGCGCGGCGGCGGGGGCGCGGG + Intronic
1062349924 9:136133518-136133540 CGGCCCCGCGGCCTGGGCGCGGG + Intergenic
1203469660 Un_GL000220v1:111021-111043 CCGCGACGCGGCGCGTGCGCGGG + Intergenic
1203477481 Un_GL000220v1:154993-155015 CCGCGACGCGGCGCGTGCGCGGG + Intergenic
1185457755 X:319232-319254 CCGAGCCTCGGCGGCGGCGGCGG + Intergenic
1185894079 X:3843216-3843238 CCGAGCCGCAGCGGCGGGGCAGG + Intronic
1185899197 X:3881640-3881662 CCGAGCCGCAGCGGCGGGGCAGG + Intergenic
1185904314 X:3920069-3920091 CCGAGCCGCAGCGGCGGGGCAGG + Intergenic
1187067298 X:15854210-15854232 CTCAGCCGCGGCGCGGGCTCGGG + Intronic
1187403608 X:18983960-18983982 CCGATCTGCCGCGTGGGCGCGGG + Exonic
1187859446 X:23667402-23667424 CCGCCCCGCCACGTGGGCGCCGG - Intronic
1189323433 X:40099183-40099205 CAGAGCCGCGCCGGGTGCGCTGG - Intronic
1190024707 X:46912670-46912692 CCGGGCCGCGGCGTGGAGCCGGG + Exonic
1198388094 X:136147545-136147567 CCGAGGCGCGGCGGTGGCGGCGG - Exonic