ID: 1150488921

View in Genome Browser
Species Human (GRCh38)
Location 17:65561356-65561378
Sequence GCCGAGCCGCGGCGTGGGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 298}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150488921_1150488926 1 Left 1150488921 17:65561356-65561378 CCGCGCCCACGCCGCGGCTCGGC 0: 1
1: 0
2: 1
3: 29
4: 298
Right 1150488926 17:65561380-65561402 CGACCTCGCCCCCTGTAAGAGGG 0: 1
1: 0
2: 0
3: 3
4: 32
1150488921_1150488937 29 Left 1150488921 17:65561356-65561378 CCGCGCCCACGCCGCGGCTCGGC 0: 1
1: 0
2: 1
3: 29
4: 298
Right 1150488937 17:65561408-65561430 TTCTTTGAAGCGGCTCCGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 36
1150488921_1150488938 30 Left 1150488921 17:65561356-65561378 CCGCGCCCACGCCGCGGCTCGGC 0: 1
1: 0
2: 1
3: 29
4: 298
Right 1150488938 17:65561409-65561431 TCTTTGAAGCGGCTCCGCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1150488921_1150488925 0 Left 1150488921 17:65561356-65561378 CCGCGCCCACGCCGCGGCTCGGC 0: 1
1: 0
2: 1
3: 29
4: 298
Right 1150488925 17:65561379-65561401 GCGACCTCGCCCCCTGTAAGAGG 0: 1
1: 0
2: 0
3: 2
4: 21
1150488921_1150488935 19 Left 1150488921 17:65561356-65561378 CCGCGCCCACGCCGCGGCTCGGC 0: 1
1: 0
2: 1
3: 29
4: 298
Right 1150488935 17:65561398-65561420 GAGGGGGGCTTTCTTTGAAGCGG 0: 1
1: 0
2: 1
3: 13
4: 153
1150488921_1150488936 28 Left 1150488921 17:65561356-65561378 CCGCGCCCACGCCGCGGCTCGGC 0: 1
1: 0
2: 1
3: 29
4: 298
Right 1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 59
1150488921_1150488927 2 Left 1150488921 17:65561356-65561378 CCGCGCCCACGCCGCGGCTCGGC 0: 1
1: 0
2: 1
3: 29
4: 298
Right 1150488927 17:65561381-65561403 GACCTCGCCCCCTGTAAGAGGGG 0: 1
1: 0
2: 0
3: 3
4: 33
1150488921_1150488928 3 Left 1150488921 17:65561356-65561378 CCGCGCCCACGCCGCGGCTCGGC 0: 1
1: 0
2: 1
3: 29
4: 298
Right 1150488928 17:65561382-65561404 ACCTCGCCCCCTGTAAGAGGGGG 0: 1
1: 0
2: 1
3: 2
4: 81
1150488921_1150488930 4 Left 1150488921 17:65561356-65561378 CCGCGCCCACGCCGCGGCTCGGC 0: 1
1: 0
2: 1
3: 29
4: 298
Right 1150488930 17:65561383-65561405 CCTCGCCCCCTGTAAGAGGGGGG 0: 1
1: 0
2: 0
3: 3
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150488921 Original CRISPR GCCGAGCCGCGGCGTGGGCG CGG (reversed) Intronic
900342282 1:2194803-2194825 GCGGGGCCGGGGCGGGGGCGGGG - Intronic
900607869 1:3531802-3531824 GCCGGGCCGCGGGGCGGGGGAGG + Intronic
901425954 1:9182562-9182584 ACCCAGCGGCGGCGTGGGCGAGG - Intergenic
902169500 1:14598790-14598812 CCCTAGCCGCGGCGGTGGCGAGG - Exonic
902214122 1:14924040-14924062 GCCGCGGCGGGGCGGGGGCGGGG + Intronic
902823381 1:18956716-18956738 GCGGGGCCGCGGCGGGGGCGGGG - Intergenic
902856571 1:19210407-19210429 GTCGAGCCGCGGCGAGGGAACGG + Intergenic
903190172 1:21651910-21651932 TCCGAGCTGGGGCGGGGGCGGGG - Intronic
903595668 1:24492276-24492298 GCAGAGTCGAGGCGGGGGCGGGG + Intergenic
903750213 1:25616799-25616821 CCCGAGCGGCGGCGGCGGCGGGG + Intergenic
905449325 1:38046762-38046784 GCGGAGCGGCGGCGGCGGCGCGG - Exonic
905912068 1:41662088-41662110 GCCAGGCCGCGGCGGGGGCGCGG + Intronic
906147005 1:43566128-43566150 GCCGAGGCGTGGTGTGGGGGAGG + Intronic
910981242 1:92961545-92961567 CGCGCGCCGCGGCGGGGGCGGGG - Intergenic
913186262 1:116373173-116373195 GACGTTTCGCGGCGTGGGCGGGG + Intronic
914758456 1:150579760-150579782 GCCGGGCCGGGGCGGGGCCGGGG + Intergenic
916717051 1:167455247-167455269 GCGGAGAGGCGGCGTGAGCGCGG - Intronic
920401630 1:205680080-205680102 GCGGGGCGGCGGTGTGGGCGGGG - Intronic
1063115127 10:3067487-3067509 GCCGGGCGGGGGCGCGGGCGGGG + Intronic
1063623194 10:7667212-7667234 GCTGGGACGCGGGGTGGGCGGGG - Intergenic
1064418116 10:15168290-15168312 GGCGAGGCCCGGGGTGGGCGGGG - Intronic
1069438296 10:68406546-68406568 GCGCAGCCGGGGCGTGGCCGCGG - Intronic
1069544542 10:69319017-69319039 GACCAGCGGCGGCGCGGGCGGGG - Intronic
1071563539 10:86660211-86660233 GCCCAGCCCCGGGGTGGGTGGGG + Intronic
1072253622 10:93600848-93600870 GGCGGGCCGCGGGGAGGGCGGGG + Intronic
1074169733 10:110919999-110920021 GGCGAGCCGGCGCGAGGGCGCGG + Intronic
1074503344 10:114044974-114044996 TCCGGGCGGCGGCGCGGGCGCGG - Exonic
1075741802 10:124700524-124700546 GCCCTGCCCCGGCGTGGGCTCGG - Intronic
1075999826 10:126905685-126905707 GCGGGGCGGCGGCGCGGGCGCGG - Intronic
1076394552 10:130129198-130129220 GCCTGGGTGCGGCGTGGGCGCGG - Intergenic
1076505418 10:130969879-130969901 GGCGGGCTGCGGCGGGGGCGGGG + Intergenic
1076683519 10:132186878-132186900 GCGGAGCCGGGGTGGGGGCGGGG + Exonic
1076876726 10:133219926-133219948 GTCCAGCCGGGGCGTGGGCCGGG - Intronic
1077015482 11:397275-397297 CCGGAGCCGCGGGGTAGGCGGGG + Exonic
1077043739 11:535460-535482 GCCGGGGCGGGGCGGGGGCGGGG + Exonic
1077044301 11:537674-537696 CCTGCGCCGAGGCGTGGGCGCGG + Intronic
1077610740 11:3641996-3642018 GCCCCGGCGGGGCGTGGGCGGGG + Exonic
1079642996 11:22829894-22829916 GCAGAGCTGCGGGGTGGGGGCGG - Intronic
1083432599 11:62622033-62622055 GCGGAGCCGCTGCAGGGGCGGGG - Exonic
1084336495 11:68460858-68460880 GCCGCGGCGCGGGGTGTGCGAGG + Intronic
1084538733 11:69774166-69774188 GCCGAGGGGCGGAGTGGGCCAGG - Intronic
1084787683 11:71453024-71453046 GTGGAGCCGGGGCGGGGGCGGGG + Intergenic
1091823259 12:3491755-3491777 GCTGAGCGGCGGCGGCGGCGCGG - Intronic
1095949314 12:47773309-47773331 GCCGAGCTGCAGCCTGGACGGGG - Exonic
1096159830 12:49367318-49367340 GGCGAGCCGCTGCCTGGGCGAGG + Intronic
1096693657 12:53335693-53335715 GCTGAGCCGGGGGGTGGGGGGGG + Exonic
1096843216 12:54391347-54391369 GCCGAGGCGGAGCGGGGGCGGGG + Intergenic
1098106004 12:67069407-67069429 GCCGGGCCGGGCCGGGGGCGGGG + Intergenic
1101371847 12:104137934-104137956 GCCGGGCCGGGGAGCGGGCGCGG - Intronic
1101479629 12:105084496-105084518 GCCTGGGCGCGGCCTGGGCGCGG + Exonic
1101640130 12:106581635-106581657 GGCGGGCCGCGGCGGGGGCGGGG - Intronic
1102278396 12:111599529-111599551 GCCGAGGCGCCGGGTGGGAGCGG + Exonic
1102465351 12:113127802-113127824 GCCGACCCCCGAGGTGGGCGAGG - Exonic
1103564683 12:121809763-121809785 GCCCAGGCGCGGTGTGAGCGGGG - Exonic
1103623893 12:122204561-122204583 GCCGGGCGGCGGCGGCGGCGGGG - Exonic
1104021182 12:124993593-124993615 GGCGGGGCGCGGCGTGGGCTGGG + Intergenic
1105011955 12:132761949-132761971 GCGGAGGCCCGGCGAGGGCGCGG + Intergenic
1105022940 12:132829156-132829178 GCCGGGGCTCGGCATGGGCGCGG + Intronic
1105745674 13:23375351-23375373 GCCGCGCCGCGATGTGGGAGAGG - Intronic
1105943641 13:25171586-25171608 CCGGAGCCGCGGCGGCGGCGGGG - Exonic
1105964415 13:25371961-25371983 CCCGGGCTGCGGCGTGGGGGCGG - Intergenic
1106340263 13:28820310-28820332 GCGCAGCCGCGGCGCGGGCGTGG + Intergenic
1108518277 13:51222579-51222601 GCCGGGCCGGGCCGCGGGCGGGG + Intronic
1110318593 13:74135544-74135566 GCCGAGCCGGAGGGTCGGCGGGG + Intergenic
1112271600 13:97975234-97975256 GCCGAGGCGGGGGGAGGGCGGGG + Intronic
1113895830 13:113764122-113764144 GATGGGCCGGGGCGTGGGCGTGG + Intronic
1115752936 14:36508416-36508438 GCGGAGACGCGGGGCGGGCGGGG + Intronic
1117478307 14:56118759-56118781 CCCGGGCAGCGGCGCGGGCGGGG + Intronic
1119003974 14:70907785-70907807 GCCGAGCTGGGGCCGGGGCGGGG + Exonic
1120521569 14:85532250-85532272 GCCGAGACGCGCCGTCGGTGGGG - Intronic
1121405204 14:93715628-93715650 GCCCAGCCAAGGGGTGGGCGTGG + Intergenic
1121453989 14:94026927-94026949 GCCGAGCCGTCGGGTGGGTGGGG - Intronic
1122162335 14:99793439-99793461 GCCGGGCCGGGGAGCGGGCGCGG + Exonic
1122221231 14:100240051-100240073 GCCGTGCGGCGGCGGGGGCGCGG + Intronic
1122581986 14:102777133-102777155 GACGCGCGGCGGCGGGGGCGCGG + Intergenic
1122917520 14:104865767-104865789 GCCGAGCCGGTGCCGGGGCGGGG - Intronic
1122975009 14:105167526-105167548 GCGGGGTCGCGGCGGGGGCGGGG - Intronic
1122975409 14:105168833-105168855 GCCGCGCCGCGGGGTGGGGCCGG + Intergenic
1123037996 14:105479081-105479103 GCCGAGCCCCGGGGCGGGGGCGG - Intronic
1124453874 15:29822556-29822578 GCGGGGCCGCGGCGGGGGAGGGG + Intronic
1124645703 15:31436411-31436433 GCCGAGCCACGGGCTGGGCATGG - Intergenic
1128547718 15:68579135-68579157 GCCGAGCCGCCGGCGGGGCGCGG + Exonic
1128547749 15:68579226-68579248 GCGGAGCGGGGGCGCGGGCGCGG - Exonic
1128758830 15:70201091-70201113 GCCGAGCCTGGGCCTGGGCGAGG + Intergenic
1129016643 15:72474586-72474608 GCCGAGGCGGGGAGAGGGCGGGG - Exonic
1129189133 15:73927404-73927426 CGCGGGCGGCGGCGTGGGCGCGG + Exonic
1129273869 15:74433206-74433228 TCCGGGCCGGGGCGGGGGCGGGG + Intronic
1130224256 15:82045722-82045744 GCCGAGGGCCGGCGGGGGCGCGG - Exonic
1130370887 15:83284592-83284614 GCCGAGCCGGGGCGGACGCGGGG - Exonic
1132398206 15:101489464-101489486 GACGGGGCGCGGCGGGGGCGCGG + Exonic
1132480580 16:164717-164739 GCGGGGCCGCGGGGCGGGCGGGG + Intronic
1132480677 16:164900-164922 GCCGGGCCGGGGCGGGGTCGCGG + Intronic
1132512908 16:352920-352942 GCGGGGCCGGGGCGTGGGCGGGG + Intergenic
1132522460 16:397817-397839 GCCGGGCAGCGGCGGGGCCGGGG - Intronic
1132548221 16:543390-543412 GCAGAGCCGCGGGGCAGGCGTGG + Intronic
1132585991 16:705952-705974 GCCGGGGCGGGGCGGGGGCGGGG - Intronic
1132591144 16:726990-727012 GCCGGGCGGGGGCGGGGGCGGGG + Intronic
1132629501 16:910342-910364 GCTGAGCCCCGGGGTGGGGGTGG - Intronic
1133188437 16:4116300-4116322 GGCGGCCCCCGGCGTGGGCGCGG - Intergenic
1135382705 16:22008042-22008064 GCGAAGCCGCGGCGTTGGCGAGG - Intronic
1135517618 16:23148950-23148972 GCACGGCGGCGGCGTGGGCGCGG + Exonic
1135712597 16:24730063-24730085 GCGGTCCCGCGGCGCGGGCGAGG - Intronic
1136554028 16:30997401-30997423 GCCAAGCACCGGCGGGGGCGTGG - Intronic
1136993327 16:35170389-35170411 GGCGGGCCGCGCGGTGGGCGCGG - Intergenic
1137251267 16:46742732-46742754 GCCCAGCACCGGCGTGGGGGAGG + Intronic
1137531600 16:49281877-49281899 GCCGGGAGGCGGCGGGGGCGGGG - Intergenic
1139954254 16:70685803-70685825 GCCGGGCCGCGGCGGCGGCTAGG + Exonic
1140097048 16:71884057-71884079 GCCGAGCCGAGCCGGTGGCGGGG + Exonic
1140927570 16:79599174-79599196 GCGGGGGCGCGGCGGGGGCGGGG - Exonic
1142156300 16:88534219-88534241 GCCGGGCGGCGGGGGGGGCGGGG - Exonic
1142226757 16:88881330-88881352 GCCGGGCCGCGGCGGGAGCGGGG + Exonic
1142474604 17:181493-181515 GCCGGGCCGCGCCCGGGGCGGGG - Exonic
1142799774 17:2337813-2337835 CCCGCGCCGGGGGGTGGGCGCGG - Intronic
1142810495 17:2393576-2393598 CCCGCGCCGCAGCGTGGACGGGG + Intronic
1143590956 17:7885532-7885554 GCCGGACGGCGGCGTGGGGGAGG + Intronic
1144816514 17:18039251-18039273 GCCGAGGCGCGGCGTGGAGGGGG - Intergenic
1144828799 17:18120821-18120843 GGAGAGCGGCGGCGCGGGCGGGG - Exonic
1146271368 17:31487962-31487984 GCCGGGGCGGGGCGGGGGCGGGG - Intronic
1147159553 17:38562278-38562300 GTTGAGGCGCCGCGTGGGCGAGG + Exonic
1148048720 17:44759088-44759110 GCGGAGCCGGGGCGGGGGCGCGG - Exonic
1148271762 17:46267015-46267037 GCTGAGGCGCGGCGGCGGCGCGG - Intergenic
1148323787 17:46771930-46771952 GGCGAGGCGCGGCGGCGGCGCGG - Intronic
1149610506 17:57955266-57955288 GCCGGGCCGCGGGCCGGGCGGGG + Exonic
1149865722 17:60150055-60150077 GCCGCGCCGCGGAGAGGGCCAGG - Exonic
1150249927 17:63699773-63699795 GCCGAGGGGCGGGGCGGGCGGGG - Intronic
1150488921 17:65561356-65561378 GCCGAGCCGCGGCGTGGGCGCGG - Intronic
1151783855 17:76265671-76265693 GCCGGGCGGCGGCGGGGGCGGGG + Intronic
1152349763 17:79778080-79778102 GGCGGGCCGGGGCGCGGGCGCGG + Intergenic
1152362538 17:79839347-79839369 GGCGAGCGGCGGCGGCGGCGGGG - Exonic
1152462858 17:80450390-80450412 GCCCTGCAGCGGCGTGGGCCGGG - Intergenic
1152737276 17:82003760-82003782 GCTGTGCCAGGGCGTGGGCGCGG - Intronic
1153201944 18:2655906-2655928 GCCGAGCAGCGGCAGGCGCGAGG - Exonic
1154274526 18:12947871-12947893 GACGGGCCGGGGCGTGGGCAGGG + Intronic
1157095002 18:44679636-44679658 GACGGGACGCGGCGGGGGCGCGG + Intergenic
1157251297 18:46098373-46098395 GCAGAGTGGCGGCGGGGGCGGGG - Intronic
1157613945 18:48975987-48976009 GCCGGGCGGCGGCGAGGGCCGGG + Intergenic
1158836324 18:61334358-61334380 GCCGAGCTCCGGCGGGGGCGCGG - Intronic
1159798457 18:72869083-72869105 CCCCAGCCGCGGCGCGGGTGTGG - Intergenic
1160543413 18:79637944-79637966 GCCGAGGCACGGCCTGGGCCCGG + Intergenic
1160577031 18:79862575-79862597 GCGCAGCCGAGGCGTGTGCGTGG + Intergenic
1160592388 18:79951699-79951721 GCGCAGCTCCGGCGTGGGCGGGG - Intergenic
1160813848 19:1026544-1026566 GCCAATCAGCGGCGGGGGCGTGG + Intergenic
1161027150 19:2042024-2042046 GCCGAGCCGCACTGCGGGCGGGG + Exonic
1161027201 19:2042207-2042229 GCGGGGCCGCGGCGGGGGAGGGG - Intronic
1161063723 19:2227595-2227617 GCCGAGCCGCTGCTTGTGCTTGG + Intronic
1161072421 19:2269531-2269553 GGCGAGCAGCGGCGGCGGCGCGG + Exonic
1161108754 19:2456853-2456875 GCCGGGCAGCGGCGTGGCCATGG + Exonic
1161218311 19:3105741-3105763 GCCGAGCAGCGGTCTGTGCGTGG + Intronic
1161249030 19:3270682-3270704 GCCGGGCCGCGGGGTGGGGACGG + Intronic
1161400768 19:4065630-4065652 GCCGGGCCCGGGCGTGGGGGAGG - Intronic
1161560298 19:4969287-4969309 CCCGAGCCGCGACGCGGGGGCGG - Intronic
1162486129 19:10961382-10961404 GCGGAGCGGCGGGGTGGGTGGGG + Intronic
1163444223 19:17337526-17337548 GTCAAGCCGCGGAGTGGGCGGGG + Intronic
1163607278 19:18281994-18282016 GCCGGGCGGGGGCGGGGGCGGGG + Intergenic
1163666673 19:18606847-18606869 GCCGGGCCGGGCCGGGGGCGGGG - Exonic
1165172956 19:33906390-33906412 GCCGAGCCTCGGTGGGGGAGGGG + Intergenic
1165204526 19:34172465-34172487 GCCGCGCCGCGGCTTGAGGGCGG + Intergenic
1165427879 19:35755750-35755772 GGTGAGCCGCGGCGTGGGGCGGG - Exonic
1165851442 19:38852195-38852217 TCCGAGCAGCGGGGTGGGGGCGG - Intronic
1166105965 19:40598206-40598228 CCCGAGCCGCGGCGGGGGCGGGG + Intronic
1166938142 19:46347293-46347315 GCGGAGCTGCAGCCTGGGCGCGG + Intronic
1166948592 19:46412141-46412163 GGCGGGCCCCGGGGTGGGCGAGG - Exonic
1166983963 19:46648987-46649009 GCTGGGCCGCGGCGTGGCCGTGG + Exonic
1168721821 19:58558543-58558565 GGCGGGCCGCGCGGTGGGCGCGG - Exonic
927216623 2:20671062-20671084 GCAGGGCAGCGGCGGGGGCGCGG + Exonic
927679785 2:25131945-25131967 GCCGAGGCGCGGAGTGGGGAGGG + Intronic
928094145 2:28393655-28393677 GCGCGGCCGCGGCGAGGGCGGGG + Exonic
928904490 2:36355834-36355856 CCCGAGCTGCCGAGTGGGCGCGG - Intergenic
929966814 2:46542762-46542784 GCCGGGCCGGGGAGAGGGCGCGG + Exonic
932699977 2:73985402-73985424 CCCGAGCGGCGGCGCGCGCGCGG + Intergenic
932773915 2:74515870-74515892 GGTGAGGCGCGGCGCGGGCGAGG + Exonic
933613275 2:84459087-84459109 GCCCAGCCGCGGCCTGGGCCAGG + Intronic
933876309 2:86623989-86624011 GCGGAGCCGCAGCGTGGTCGGGG + Intronic
934933276 2:98445335-98445357 GCCGAGCGGGCGCGTGGCCGCGG + Intronic
935112307 2:100104765-100104787 GCCGGGCCGCCGCGAGGGAGGGG - Intronic
935249973 2:101252752-101252774 GCGGAGACGCGGGGTAGGCGGGG - Intronic
935349689 2:102142701-102142723 GCCCCGCCGCTGCGGGGGCGGGG - Intronic
936433266 2:112482240-112482262 GCCGGGCCGCGGCGGGCGCCCGG + Exonic
937325686 2:120988613-120988635 GCCCGGCAGCGGAGTGGGCGGGG - Exonic
937868637 2:126772023-126772045 GCCTGGCCGTGGTGTGGGCGTGG - Intergenic
940316702 2:152335098-152335120 GCGGAGCCGGGCCGGGGGCGGGG + Intergenic
940918889 2:159286550-159286572 GCTGAGCCGGCCCGTGGGCGCGG + Exonic
941916753 2:170818236-170818258 GCCGAGACGAGGCGGGGTCGGGG - Intronic
942565909 2:177264630-177264652 GCCGAGGCGCGGCGCGGACAGGG + Exonic
942811652 2:180007016-180007038 GCAGAGACGCGGAGTGGGGGTGG - Exonic
945699544 2:213152278-213152300 GCCGAGTCGGGGAGTGTGCGTGG + Intronic
946306526 2:218859750-218859772 GCGGGGCCGAGGCGGGGGCGGGG - Intergenic
947117946 2:226791678-226791700 GCTGAGCCGCGGCGGGCGCGGGG - Intronic
947869215 2:233423649-233423671 GCCTAGCTGCGGCCTGGGAGTGG + Intronic
948140444 2:235669379-235669401 GCCAAGCCCCAGAGTGGGCGTGG + Intronic
948824681 2:240568504-240568526 GCCGGGCGGCGGCGGCGGCGGGG - Intronic
948824695 2:240568530-240568552 GCCGCGCCGGGCCGCGGGCGAGG - Intronic
948910121 2:240998653-240998675 GCGGAGCTGCGGCGAGAGCGCGG + Intergenic
948988716 2:241541258-241541280 GCGGGGCCGCGGCGGGGGCGGGG + Intergenic
949004328 2:241636899-241636921 GCCGGGTCGGGGCGGGGGCGTGG + Intronic
1168802673 20:653298-653320 GCCGGACCGCGGCGGGGTCGGGG - Exonic
1171284900 20:23928956-23928978 GCCCAGCCTCAGAGTGGGCGGGG + Intergenic
1173548025 20:43914457-43914479 CCCGCCCCGCGGCGTGGGTGCGG - Intergenic
1173741736 20:45406668-45406690 GCGAGGCCGCGGCGGGGGCGTGG - Intronic
1175847507 20:62066201-62066223 GCCGGGCCGAGGCGGGCGCGGGG + Intergenic
1176099773 20:63359658-63359680 GCCGCTCCTCGGCGTGGGCCCGG + Exonic
1176281624 20:64316744-64316766 GGCGGGGCGCGGCGGGGGCGCGG + Intergenic
1179304773 21:40144314-40144336 GCAGATCAGCGGGGTGGGCGAGG + Intronic
1179529594 21:42009795-42009817 CCCGGGCCGCGGGGTGTGCGCGG - Intronic
1180014731 21:45074674-45074696 GCAGCGGCGCGGCGTGGCCGTGG - Intronic
1180782529 22:18529128-18529150 GCGGAGCAGCAGCGTGAGCGGGG + Intronic
1180951936 22:19724389-19724411 GCCGGGCTGCGGCGCGAGCGCGG - Exonic
1181126081 22:20703157-20703179 GCGGAGCAGCAGCGTGAGCGGGG + Intergenic
1183720133 22:39557772-39557794 TCCGGGCCGGGGCGGGGGCGCGG - Intergenic
1183951623 22:41355937-41355959 GCAGAGCTGTGGGGTGGGCGTGG - Exonic
1185285887 22:49999727-49999749 GGCGGGGCGCGGGGTGGGCGGGG + Intronic
1185313799 22:50170395-50170417 GCCGGGCCGGGGCGGCGGCGGGG - Intergenic
1185337613 22:50277771-50277793 GCTGGGCCGCGGGGTGGGTGTGG + Intronic
1185337631 22:50277822-50277844 GCTGGGCCGCGGGGTGGGTGTGG + Intronic
950065492 3:10108335-10108357 CCCGAGCCGCGGCGGGGATGGGG + Intergenic
950829528 3:15859964-15859986 GCGGGGCCGCGGCTCGGGCGGGG + Intergenic
954778816 3:53045158-53045180 GGCGGGCCGCGGCGCGGGAGAGG + Intronic
956675016 3:71725269-71725291 GCCGAGCGGCGGCTCGGGGGCGG + Exonic
961545352 3:127629320-127629342 GGCGGGCGGCGGCGTGGGCGCGG + Intronic
962134741 3:132722157-132722179 GCTGCCCCGCGGGGTGGGCGCGG - Exonic
964569213 3:158094504-158094526 GTCGGGCCGCGGCGGGAGCGCGG - Intergenic
964876251 3:161371966-161371988 CCCGAGCCGAGGCGGGGACGGGG + Exonic
965404104 3:168249461-168249483 ACCCAGCCGCGGCGGGGGCTGGG - Intergenic
967924129 3:194633206-194633228 GCCCAGCCGCGCCATGGGGGAGG - Exonic
968225618 3:196970122-196970144 GCCGACCCTCGGCGGCGGCGCGG - Intergenic
968372665 4:10566-10588 GTTGCGCCGGGGCGTGGGCGCGG + Intergenic
968479255 4:826368-826390 GCGGACCCGGGGCGGGGGCGGGG + Intergenic
968739814 4:2321837-2321859 GCCGGGCAGCAGCGTGGCCGAGG + Intronic
969714276 4:8860948-8860970 GCCGGGCGGGGGCGGGGGCGAGG + Intronic
972675622 4:41257243-41257265 GCCGGGCTGGGGCGTGGGCTGGG + Intronic
973635944 4:52862208-52862230 GCGGAGCGGCGCCGGGGGCGGGG + Intergenic
974079313 4:57195873-57195895 GCCGCGGCGCGGAGTGGGAGAGG + Intergenic
975666653 4:76740454-76740476 GCCGAGGCGCTGCCTGGGCCGGG - Exonic
979785684 4:124712798-124712820 GCCGAGCGGCGGGGCGGGGGCGG - Intergenic
983577180 4:169271499-169271521 GGCGAGTCGCGGCGCGGGAGGGG + Intergenic
984928367 4:184826037-184826059 GCTCAGCCGCGGCGGTGGCGGGG - Intronic
985006010 4:185535665-185535687 CCCGGGCCGCGGCGGGCGCGGGG + Intergenic
985273746 4:188218562-188218584 GCAGGGGCGCGGCGTGGGGGTGG + Intergenic
985512617 5:321085-321107 GCCGACCGGCGGGGTGGGCGGGG + Intronic
986608624 5:9546177-9546199 GCGGCGCGGCGGCGGGGGCGGGG - Intergenic
996398369 5:123035444-123035466 GCCGTGCCACGTTGTGGGCGGGG - Intronic
999399350 5:151252795-151252817 GCCGAGCGGAGTCGGGGGCGGGG - Intronic
1001401892 5:171450944-171450966 GGCGGGCCGCGGCGTGGGCACGG - Intronic
1002193195 5:177489491-177489513 GCTCTGCAGCGGCGTGGGCGTGG + Exonic
1002296083 5:178232210-178232232 GCCGAACAGCGGTGAGGGCGGGG + Intronic
1002498513 5:179632370-179632392 GCCTGGCCGCGGCGGGGGAGGGG - Intronic
1002646504 5:180659166-180659188 GCGGGGACGCGGGGTGGGCGAGG - Intergenic
1003078013 6:2999675-2999697 GCCGAGGCGAGGTGTGGGTGGGG + Intronic
1003078043 6:2999759-2999781 GCCGGGGCGGGGAGTGGGCGGGG + Intronic
1005959952 6:30687346-30687368 GCGGAGCCGAGGAGAGGGCGGGG + Exonic
1006089608 6:31620722-31620744 GCTCAGCCGCGGAGTGAGCGAGG + Exonic
1007589817 6:43014319-43014341 GCCGAGCCGGGGCGGGGCCGCGG - Exonic
1010703235 6:79077567-79077589 GCCGGGGCGCGGGGCGGGCGGGG - Intronic
1012530442 6:100229177-100229199 CCCGAGCGGCGGCGAGGCCGAGG - Intergenic
1015773537 6:136792271-136792293 GCGGCGCGGCGGCGAGGGCGCGG - Exonic
1016714096 6:147204075-147204097 GGCGAGCAGCGGCGCGGCCGCGG + Intergenic
1016714115 6:147204133-147204155 GGCGAGCCGGGGCGGCGGCGCGG + Intergenic
1018778998 6:167045355-167045377 GCTGGGCCGCGGGGGGGGCGGGG - Exonic
1019197712 6:170291686-170291708 GCAGAGCCGACGCGCGGGCGGGG + Intergenic
1019303663 7:322303-322325 GCCGGGCCGCGGGCTGGGCCAGG + Intergenic
1019536170 7:1530923-1530945 CCCGGGCCGCGGCGGGGACGGGG + Intronic
1021653659 7:22854371-22854393 GCCGAGCCGAGGCCTCGGCGTGG - Intergenic
1021958803 7:25852590-25852612 CCCGAGCCGGGGCGGGGGCGCGG - Intergenic
1022109669 7:27220593-27220615 GCCGGGCCGCGGGGCTGGCGGGG + Intergenic
1022923421 7:35037705-35037727 GCAGAGGGGCGGCGGGGGCGGGG - Intronic
1023791679 7:43758332-43758354 GCCTGGCCCCGGCGTGGGGGGGG - Intergenic
1023879500 7:44310062-44310084 GCCGAGACCGGGCGGGGGCGGGG + Intronic
1025261722 7:57424814-57424836 GCCGGGCTGGGGCGTGGGTGGGG - Intergenic
1026765165 7:73155458-73155480 GCGAAGCGGCGGCGGGGGCGGGG - Intergenic
1027041638 7:74965213-74965235 GCGAAGCGGCGGCGGGGGCGGGG - Intronic
1027082004 7:75237156-75237178 GCGAAGCGGCGGCGGGGGCGGGG + Intergenic
1029168903 7:98617290-98617312 GCCGAGCAGCGCGGTGGGTGCGG + Exonic
1029273853 7:99392889-99392911 GCCGGGCCGGCGGGTGGGCGGGG + Intronic
1029274636 7:99396862-99396884 GAAGAGCCGAGGCGTGGGAGAGG + Intronic
1029390587 7:100271701-100271723 GCGAAGCGGCGGCGGGGGCGGGG + Intronic
1029456176 7:100673701-100673723 GCCCAGCCGGGTCCTGGGCGCGG + Exonic
1030216071 7:107044851-107044873 GCCGTGCCGGGGAGGGGGCGAGG + Exonic
1032306036 7:130733490-130733512 CCTGATCCGCGGCGGGGGCGGGG + Exonic
1034621976 7:152463743-152463765 GGCGGGCCGGGGCGAGGGCGGGG + Intergenic
1034621993 7:152463793-152463815 GGCGGGCCGGGGCGAGGGCGGGG + Intergenic
1037826774 8:22164786-22164808 ACCGACCCGAGGCGGGGGCGCGG + Exonic
1038726061 8:30083257-30083279 GTGGCGCCGCGGTGTGGGCGGGG + Intergenic
1038828713 8:31033715-31033737 GGCGAGCCGGGCCGGGGGCGGGG + Exonic
1039415857 8:37393662-37393684 GCCCAGGGGCGGGGTGGGCGGGG - Intergenic
1042059115 8:64798503-64798525 GCAGGGCCGCGGCGAGGGCCAGG + Exonic
1042591534 8:70402882-70402904 GCCGGGCCGTGGTGGGGGCGGGG - Intronic
1043296128 8:78665979-78666001 GCGGGGCCGCGGCGGAGGCGAGG - Intergenic
1044999697 8:97869017-97869039 GCGGTGCCGCGGCGGGGGTGGGG - Intronic
1049194626 8:141308486-141308508 GCAGGGGCGCGGCGGGGGCGGGG - Intergenic
1049405271 8:142449586-142449608 GCCAAGCCGAGCCGGGGGCGGGG - Exonic
1049419666 8:142511105-142511127 GCCGGGCAGGGGCGCGGGCGGGG + Intronic
1049620943 8:143598016-143598038 GCGGGGCCGCGGCCCGGGCGCGG - Exonic
1049776721 8:144409389-144409411 GCAGCGCCGCCGCGTGAGCGTGG + Intergenic
1049873815 8:145002626-145002648 GCCGAGGCGCGGGCAGGGCGAGG - Intergenic
1050357059 9:4793241-4793263 GGCGGCGCGCGGCGTGGGCGCGG + Intronic
1052862914 9:33447702-33447724 GCCGAGGTGGGGCGGGGGCGAGG - Intergenic
1053752912 9:41274039-41274061 GCAGAGCCCCGGCGCAGGCGCGG - Intergenic
1055757318 9:79570979-79571001 CCGGGGCCGCGGGGTGGGCGGGG - Intergenic
1056992357 9:91423747-91423769 GGCGGGCGGCGGCGAGGGCGCGG + Exonic
1057443706 9:95099422-95099444 GCGGGGACGCGGCGTGGCCGAGG - Exonic
1057773326 9:97984980-97985002 GCGGCGCGGCTGCGTGGGCGTGG + Intronic
1057773345 9:97985067-97985089 GCCGGTCCGCGGCGGGGGGGGGG - Intronic
1059102479 9:111483828-111483850 GCAGAGCCGCCGCGCGGGCCTGG - Intronic
1059470932 9:114504711-114504733 GGCGGGCGGCGGCGGGGGCGCGG - Exonic
1060779098 9:126398671-126398693 GCCCAGCCGTGGCGGTGGCGGGG + Intronic
1060974150 9:127754926-127754948 GCCGACCCGGGGAGGGGGCGGGG - Intronic
1061084928 9:128393128-128393150 CCCGAGCCGGTGCGTGCGCGGGG - Intergenic
1061261397 9:129482707-129482729 GCGCCGCCGCGGCGTGGGGGCGG + Intergenic
1061485608 9:130919116-130919138 GCTGAGCCACGGCGGGCGCGGGG + Intronic
1062022579 9:134326396-134326418 GGCGCGCGGCGGCGGGGGCGCGG + Intronic
1062286003 9:135772758-135772780 GCAGAGCGGCGGTGGGGGCGGGG + Exonic
1062341414 9:136095310-136095332 GCCGCACCGCGGCGGGGGCGGGG + Intergenic
1062349646 9:136132679-136132701 GCCGAGCCGCGGCCCCAGCGAGG - Intergenic
1062349923 9:136133517-136133539 GCGGCCCCGCGGCCTGGGCGCGG + Intergenic
1062467445 9:136687464-136687486 GGCGGGGCGCGGCGTGGGGGAGG + Intergenic
1062574630 9:137200478-137200500 GCGGGGGCGCGGCGGGGGCGCGG - Exonic
1062574635 9:137200489-137200511 GCGGCGGCGCGGCGGGGGCGCGG - Exonic
1062574637 9:137200494-137200516 GCCGAGCGGCGGCGCGGCGGGGG - Exonic
1062653492 9:137590310-137590332 GCCGAGCGGGGGCCGGGGCGAGG + Exonic
1187067297 X:15854209-15854231 GCTCAGCCGCGGCGCGGGCTCGG + Intronic
1187403606 X:18983959-18983981 CCCGATCTGCCGCGTGGGCGCGG + Exonic
1189262584 X:39689038-39689060 GCGGAGCCGCGGGGAGGGCGCGG + Intergenic
1190024705 X:46912669-46912691 GCCGGGCCGCGGCGTGGAGCCGG + Exonic
1192795742 X:74422765-74422787 GCCGAGCCCCAGAGCGGGCGGGG + Intronic
1194666899 X:96685340-96685362 GCCGAGGCGCGGAGACGGCGTGG + Intronic
1196001981 X:110795946-110795968 GCAGAGCCAAGGCGCGGGCGCGG + Intergenic
1198388137 X:136147716-136147738 CCCGAGCGGCGGCGGCGGCGGGG - Intronic
1200209806 X:154342220-154342242 GCGGTGCCGAGGCGGGGGCGGGG - Intergenic
1200221046 X:154389872-154389894 GCGGTGCCGAGGCGGGGGCGGGG + Intergenic