ID: 1150488922

View in Genome Browser
Species Human (GRCh38)
Location 17:65561361-65561383
Sequence GTCGCGCCGAGCCGCGGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 48}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150488922_1150488927 -3 Left 1150488922 17:65561361-65561383 CCCACGCCGCGGCTCGGCGCGAC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1150488927 17:65561381-65561403 GACCTCGCCCCCTGTAAGAGGGG 0: 1
1: 0
2: 0
3: 3
4: 33
1150488922_1150488938 25 Left 1150488922 17:65561361-65561383 CCCACGCCGCGGCTCGGCGCGAC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1150488938 17:65561409-65561431 TCTTTGAAGCGGCTCCGCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1150488922_1150488925 -5 Left 1150488922 17:65561361-65561383 CCCACGCCGCGGCTCGGCGCGAC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1150488925 17:65561379-65561401 GCGACCTCGCCCCCTGTAAGAGG 0: 1
1: 0
2: 0
3: 2
4: 21
1150488922_1150488937 24 Left 1150488922 17:65561361-65561383 CCCACGCCGCGGCTCGGCGCGAC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1150488937 17:65561408-65561430 TTCTTTGAAGCGGCTCCGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 36
1150488922_1150488928 -2 Left 1150488922 17:65561361-65561383 CCCACGCCGCGGCTCGGCGCGAC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1150488928 17:65561382-65561404 ACCTCGCCCCCTGTAAGAGGGGG 0: 1
1: 0
2: 1
3: 2
4: 81
1150488922_1150488936 23 Left 1150488922 17:65561361-65561383 CCCACGCCGCGGCTCGGCGCGAC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 59
1150488922_1150488926 -4 Left 1150488922 17:65561361-65561383 CCCACGCCGCGGCTCGGCGCGAC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1150488926 17:65561380-65561402 CGACCTCGCCCCCTGTAAGAGGG 0: 1
1: 0
2: 0
3: 3
4: 32
1150488922_1150488935 14 Left 1150488922 17:65561361-65561383 CCCACGCCGCGGCTCGGCGCGAC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1150488935 17:65561398-65561420 GAGGGGGGCTTTCTTTGAAGCGG 0: 1
1: 0
2: 1
3: 13
4: 153
1150488922_1150488930 -1 Left 1150488922 17:65561361-65561383 CCCACGCCGCGGCTCGGCGCGAC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1150488930 17:65561383-65561405 CCTCGCCCCCTGTAAGAGGGGGG 0: 1
1: 0
2: 0
3: 3
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150488922 Original CRISPR GTCGCGCCGAGCCGCGGCGT GGG (reversed) Intronic
901540067 1:9910029-9910051 GCCGCGCCGCGCCGGGGCTTGGG - Intronic
903514779 1:23902974-23902996 CTCGCGCCGCGCCGGGGCCTCGG + Intronic
907905674 1:58782514-58782536 GGCGCGCTGAGCAGCGGCGGCGG - Exonic
1065099615 10:22320909-22320931 CTCGCTCCGCGCCGCGGCGGCGG - Intronic
1067951226 10:50739902-50739924 GTCGCGCCGACTCGCGGGGAGGG - Intronic
1081492580 11:43579617-43579639 GTTGCCCCGCGCCGCGGCGGCGG + Intronic
1083430680 11:62612469-62612491 GTTGCTCCGAGCGGCGGCGGCGG + Exonic
1084165405 11:67372940-67372962 GACGGGCCGAGCCGCGCCGCGGG - Intronic
1102278395 12:111599524-111599546 GGCGCGCCGAGGCGCCGGGTGGG + Exonic
1104602448 12:130162666-130162688 CTCGCGCCGGGCCGCTGCGCCGG + Exonic
1105943407 13:25170687-25170709 GGCGCGCCGAGCCGGGGCCCGGG - Exonic
1112461443 13:99606722-99606744 GGCGCGCGGAGCTGCGGCGGCGG + Exonic
1121690964 14:95876863-95876885 CTCCCGCCGAGCCCCGGCGCGGG + Intergenic
1122993246 14:105248790-105248812 CTCGCGCCGCGCCGGGGCCTCGG - Exonic
1123004484 14:105314775-105314797 GACGGGCCGGGCCCCGGCGTCGG - Exonic
1139551437 16:67675232-67675254 GTCGAGCCGATCCGGGGAGTGGG - Exonic
1141924743 16:87160714-87160736 GTCCAGCAGAGCCGCGACGTCGG + Intronic
1142012916 16:87726243-87726265 GACGGGCCGAGGCGCGGCGTGGG - Intronic
1142389403 16:89789016-89789038 GTCTCCCCGAGCCGCGGCTCAGG - Intronic
1143016450 17:3893285-3893307 GTCCCTCCCGGCCGCGGCGTGGG + Intronic
1145815749 17:27793790-27793812 GGCGAGCCGAGCAGCGGCGGGGG + Intronic
1150488922 17:65561361-65561383 GTCGCGCCGAGCCGCGGCGTGGG - Intronic
1152032442 17:77852832-77852854 GCAGGGCAGAGCCGCGGCGTGGG + Intergenic
1153855106 18:9137245-9137267 GTCGCGAGGAGCCGCGGCGCAGG + Intronic
1158718238 18:59899778-59899800 GCGGCGCCGACCCGCGGCGGGGG - Intergenic
1166084665 19:40467030-40467052 GTCACACCCGGCCGCGGCGTGGG - Intronic
1167145738 19:47680154-47680176 GTGGCGACGAGCCGAGGCCTGGG - Exonic
929033878 2:37672530-37672552 GGCGCGCCGGGCGGCGGCGCTGG - Intronic
931868267 2:66434188-66434210 GCCGCGCCGCGCCGCGCCCTGGG + Intronic
934763843 2:96869745-96869767 GGCGCGGGGAGCCGCGGCGGCGG - Intronic
935622926 2:105144382-105144404 GGCCCGCCGGGCCGCGGGGTCGG + Intergenic
937418636 2:121737137-121737159 GTCGCGCGGAGGCGCGACATGGG + Intronic
937418648 2:121737190-121737212 GTAGCGCCGAGGCGCGGAGGCGG + Intronic
946702201 2:222424797-222424819 GCTGCGCAGAGCCGCGGCGCCGG + Exonic
1168757185 20:325806-325828 GCCGGGCCGAGCCGCGGGGCGGG + Exonic
1176100120 20:63360973-63360995 GTCGCGCGCACCCGCGGCTTGGG + Intronic
1185055439 22:48576341-48576363 GTCGCGGCGGAGCGCGGCGTTGG + Intronic
1185088060 22:48751312-48751334 GTCGCGCCGGGCAGAGGCGCAGG + Intronic
955916480 3:63912634-63912656 GCCGCGCCGCGCGGCGGCGGCGG + Exonic
978619399 4:110623229-110623251 GACGCCCCGAGCCGCGGTGGAGG + Intronic
986608433 5:9545508-9545530 GCCGCGCCGCGCCGCGCCGCTGG - Intronic
1010222760 6:73462009-73462031 GCCGCACCGAGCGGCGGCGGTGG - Exonic
1021653660 7:22854376-22854398 GCGGCGCCGAGCCGAGGCCTCGG - Intergenic
1026776598 7:73234861-73234883 GACGCGCCTGGCCGCGGTGTGGG + Intergenic
1027017449 7:74788231-74788253 GACGCGCCTGGCCGCGGTGTGGG + Intronic
1027070573 7:75157701-75157723 GACGCGCCTGGCCGCGGTGTGGG - Intergenic
1033654359 7:143362802-143362824 GGCGAGCCGAGCCGGGGCGGGGG - Intergenic
1061190874 9:129081865-129081887 GTGGCGCAGAGCCTGGGCGTGGG + Intronic
1061438141 9:130579620-130579642 GGGGAGCCGAGCGGCGGCGTCGG + Exonic
1062696260 9:137877761-137877783 GTGGCGCGGGGCCGCGGAGTCGG + Intergenic
1200157045 X:153982383-153982405 GTGGCGCCGTGCCGCGGTGCTGG + Exonic