ID: 1150488922

View in Genome Browser
Species Human (GRCh38)
Location 17:65561361-65561383
Sequence GTCGCGCCGAGCCGCGGCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 48}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150488922_1150488936 23 Left 1150488922 17:65561361-65561383 CCCACGCCGCGGCTCGGCGCGAC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 59
1150488922_1150488926 -4 Left 1150488922 17:65561361-65561383 CCCACGCCGCGGCTCGGCGCGAC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1150488926 17:65561380-65561402 CGACCTCGCCCCCTGTAAGAGGG 0: 1
1: 0
2: 0
3: 3
4: 32
1150488922_1150488927 -3 Left 1150488922 17:65561361-65561383 CCCACGCCGCGGCTCGGCGCGAC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1150488927 17:65561381-65561403 GACCTCGCCCCCTGTAAGAGGGG 0: 1
1: 0
2: 0
3: 3
4: 33
1150488922_1150488930 -1 Left 1150488922 17:65561361-65561383 CCCACGCCGCGGCTCGGCGCGAC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1150488930 17:65561383-65561405 CCTCGCCCCCTGTAAGAGGGGGG 0: 1
1: 0
2: 0
3: 3
4: 88
1150488922_1150488935 14 Left 1150488922 17:65561361-65561383 CCCACGCCGCGGCTCGGCGCGAC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1150488935 17:65561398-65561420 GAGGGGGGCTTTCTTTGAAGCGG 0: 1
1: 0
2: 1
3: 13
4: 153
1150488922_1150488938 25 Left 1150488922 17:65561361-65561383 CCCACGCCGCGGCTCGGCGCGAC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1150488938 17:65561409-65561431 TCTTTGAAGCGGCTCCGCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1150488922_1150488937 24 Left 1150488922 17:65561361-65561383 CCCACGCCGCGGCTCGGCGCGAC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1150488937 17:65561408-65561430 TTCTTTGAAGCGGCTCCGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 36
1150488922_1150488925 -5 Left 1150488922 17:65561361-65561383 CCCACGCCGCGGCTCGGCGCGAC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1150488925 17:65561379-65561401 GCGACCTCGCCCCCTGTAAGAGG 0: 1
1: 0
2: 0
3: 2
4: 21
1150488922_1150488928 -2 Left 1150488922 17:65561361-65561383 CCCACGCCGCGGCTCGGCGCGAC 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1150488928 17:65561382-65561404 ACCTCGCCCCCTGTAAGAGGGGG 0: 1
1: 0
2: 1
3: 2
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150488922 Original CRISPR GTCGCGCCGAGCCGCGGCGT GGG (reversed) Intronic