ID: 1150488923

View in Genome Browser
Species Human (GRCh38)
Location 17:65561362-65561384
Sequence GGTCGCGCCGAGCCGCGGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 129}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150488923_1150488936 22 Left 1150488923 17:65561362-65561384 CCACGCCGCGGCTCGGCGCGACC 0: 1
1: 0
2: 0
3: 16
4: 129
Right 1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 59
1150488923_1150488938 24 Left 1150488923 17:65561362-65561384 CCACGCCGCGGCTCGGCGCGACC 0: 1
1: 0
2: 0
3: 16
4: 129
Right 1150488938 17:65561409-65561431 TCTTTGAAGCGGCTCCGCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1150488923_1150488937 23 Left 1150488923 17:65561362-65561384 CCACGCCGCGGCTCGGCGCGACC 0: 1
1: 0
2: 0
3: 16
4: 129
Right 1150488937 17:65561408-65561430 TTCTTTGAAGCGGCTCCGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 36
1150488923_1150488925 -6 Left 1150488923 17:65561362-65561384 CCACGCCGCGGCTCGGCGCGACC 0: 1
1: 0
2: 0
3: 16
4: 129
Right 1150488925 17:65561379-65561401 GCGACCTCGCCCCCTGTAAGAGG 0: 1
1: 0
2: 0
3: 2
4: 21
1150488923_1150488930 -2 Left 1150488923 17:65561362-65561384 CCACGCCGCGGCTCGGCGCGACC 0: 1
1: 0
2: 0
3: 16
4: 129
Right 1150488930 17:65561383-65561405 CCTCGCCCCCTGTAAGAGGGGGG 0: 1
1: 0
2: 0
3: 3
4: 88
1150488923_1150488926 -5 Left 1150488923 17:65561362-65561384 CCACGCCGCGGCTCGGCGCGACC 0: 1
1: 0
2: 0
3: 16
4: 129
Right 1150488926 17:65561380-65561402 CGACCTCGCCCCCTGTAAGAGGG 0: 1
1: 0
2: 0
3: 3
4: 32
1150488923_1150488927 -4 Left 1150488923 17:65561362-65561384 CCACGCCGCGGCTCGGCGCGACC 0: 1
1: 0
2: 0
3: 16
4: 129
Right 1150488927 17:65561381-65561403 GACCTCGCCCCCTGTAAGAGGGG 0: 1
1: 0
2: 0
3: 3
4: 33
1150488923_1150488935 13 Left 1150488923 17:65561362-65561384 CCACGCCGCGGCTCGGCGCGACC 0: 1
1: 0
2: 0
3: 16
4: 129
Right 1150488935 17:65561398-65561420 GAGGGGGGCTTTCTTTGAAGCGG 0: 1
1: 0
2: 1
3: 13
4: 153
1150488923_1150488928 -3 Left 1150488923 17:65561362-65561384 CCACGCCGCGGCTCGGCGCGACC 0: 1
1: 0
2: 0
3: 16
4: 129
Right 1150488928 17:65561382-65561404 ACCTCGCCCCCTGTAAGAGGGGG 0: 1
1: 0
2: 1
3: 2
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150488923 Original CRISPR GGTCGCGCCGAGCCGCGGCG TGG (reversed) Intronic
900077261 1:827589-827611 GGCCGGGCCGGGCCGGGGCGGGG + Intergenic
900349746 1:2228688-2228710 GGGCGCGCGGGGCGGCGGCGGGG + Exonic
901540071 1:9910035-9910057 GCCCGCGCCGCGCCGCGCCGGGG - Intronic
903603044 1:24556089-24556111 GGCAGCGCCGGGCGGCGGCGGGG + Exonic
904050170 1:27634164-27634186 GGCCGCGCTGGGCCGCCGCGGGG - Intronic
904245137 1:29182014-29182036 GGGCGCGCCGACGTGCGGCGGGG + Intergenic
904641913 1:31937850-31937872 GGCCGGGCCGGGCCGGGGCGGGG - Intronic
913144504 1:115976468-115976490 GGGCGGGCCGGGCCGGGGCGGGG - Intergenic
914022826 1:143885094-143885116 GGTGGCGCCGCGCCGGGGCCCGG - Intergenic
914661313 1:149793038-149793060 GGTGGCGCCGCGCCGGGGCCCGG - Intronic
915161261 1:153922520-153922542 GGGCGCGCCGTGCCGGGGTGGGG + Intronic
916729563 1:167553787-167553809 GGGCGCGCCGAGCTCCGGCTGGG - Intergenic
922315053 1:224434614-224434636 GGTCGCGCCGGGGGGCGCCGCGG + Intronic
922958627 1:229626023-229626045 GGCCGCCCAGAGCGGCGGCGGGG - Exonic
923055923 1:230425996-230426018 GGGGGCGGCGGGCCGCGGCGCGG - Intergenic
1067060882 10:43077375-43077397 GTTGGCGCCGAGCAGCGGAGCGG + Intronic
1067951227 10:50739903-50739925 CGTCGCGCCGACTCGCGGGGAGG - Intronic
1069709180 10:70478338-70478360 GGTCCCGCCGAGGCTCGGCCTGG + Intergenic
1075144453 10:119872137-119872159 GGGCCCGCAGAGCCGCGGGGAGG - Intronic
1075616127 10:123891851-123891873 GGGCGCGCAGAGGCGCGGGGCGG + Intronic
1076850032 10:133088172-133088194 GGACGCGCGGGGCCGCGGCTCGG + Intronic
1077021062 11:417343-417365 GCTCGCGCCGGGCGGGGGCGGGG + Intronic
1077495422 11:2884632-2884654 GGCCGGGCCGGGCCGGGGCGGGG + Intronic
1082802845 11:57427071-57427093 GGGCGCGGAGAGCCCCGGCGCGG - Exonic
1084151329 11:67289257-67289279 GGCTGCGCCGGGCCGGGGCGGGG - Intronic
1084165406 11:67372941-67372963 GGACGGGCCGAGCCGCGCCGCGG - Intronic
1084758060 11:71251722-71251744 GGTCGCGCTGAGCCACAGCCGGG - Intronic
1096140057 12:49235347-49235369 GGACGCGCCGCGCCGCTGCAAGG + Intronic
1097155092 12:57006520-57006542 CGTCGCGGCGAGCCGCGCGGCGG - Intergenic
1098320642 12:69239897-69239919 GGGCGCGGCGAGTCGCCGCGGGG + Intronic
1101813679 12:108129498-108129520 GGGTGCCCCGAGCCGCGGCGAGG - Intronic
1102278394 12:111599523-111599545 GGGCGCGCCGAGGCGCCGGGTGG + Exonic
1102681325 12:114692492-114692514 GGGCGCGGCGCGGCGCGGCGCGG + Intergenic
1105809322 13:23980308-23980330 GGAGGGGCCGAGCCGCAGCGTGG + Intronic
1105890783 13:24680929-24680951 GGCCGCACGGAGCCGTGGCGGGG - Intronic
1105943408 13:25170688-25170710 CGGCGCGCCGAGCCGGGGCCCGG - Exonic
1115768491 14:36647354-36647376 GGTCCCGCCCGGCCGCGGCCTGG + Intergenic
1118366771 14:65102750-65102772 GGGCGGGGAGAGCCGCGGCGCGG + Intergenic
1121617013 14:95319985-95320007 GCTCGCGCCAGCCCGCGGCGGGG - Intergenic
1121690963 14:95876862-95876884 CCTCCCGCCGAGCCCCGGCGCGG + Intergenic
1122220957 14:100238977-100238999 GGTTGCGGCGAGGCGAGGCGAGG + Exonic
1122230946 14:100306162-100306184 GGCCGGGCCGGGCCGGGGCGAGG - Intronic
1122975380 14:105168714-105168736 GGGCGCGCAGAGCCGAGGCCGGG - Exonic
1125035808 15:35122154-35122176 GTGCGCGCCGAGCCCCGGCCCGG - Intergenic
1127293664 15:57591857-57591879 GGCCGGGCCGGGCCGGGGCGGGG - Intergenic
1128264020 15:66252605-66252627 GGGAGCGCCGAGCCTCGGCGTGG - Intronic
1131257314 15:90871358-90871380 GGACGCGCCGGGCGGCCGCGAGG + Intronic
1132480676 16:164894-164916 GGGCGGGCCGGGCCGGGGCGGGG + Intronic
1132483960 16:180762-180784 GGACGCGCTGAGCCTCGCCGTGG + Exonic
1132779434 16:1614512-1614534 GGCCGGGCCGAGCCGCCGAGAGG + Intronic
1133136632 16:3717141-3717163 GGTCGGGCGGAGCGGCTGCGGGG - Intronic
1136498404 16:30658027-30658049 GGCCGCGCCGAGCGGCGGAAAGG + Intergenic
1139551438 16:67675233-67675255 GGTCGAGCCGATCCGGGGAGTGG - Exonic
1142012917 16:87726244-87726266 AGACGGGCCGAGGCGCGGCGTGG - Intronic
1144586836 17:16492225-16492247 GGCCGAGCCGGGCCGGGGCGGGG - Intergenic
1144586839 17:16492230-16492252 GGGCGGGCCGAGCCGGGCCGGGG - Intergenic
1145743196 17:27293562-27293584 GATCGCGCCGCACCGCGCCGCGG - Intergenic
1145815748 17:27793789-27793811 GGGCGAGCCGAGCAGCGGCGGGG + Intronic
1146057714 17:29589485-29589507 GGGCGCGCGGAGCCTCGCCGGGG - Exonic
1146398688 17:32487385-32487407 GGGTGCGCCGAGGCGCGGGGCGG + Intronic
1146763478 17:35498056-35498078 GGCCGCCCAGAGCGGCGGCGAGG + Intronic
1147400701 17:40178457-40178479 GGTGGCGCCGTGCCGGGGCTTGG + Intronic
1149772533 17:59332404-59332426 GGAGGCGCCGAGACGCGGCCAGG - Intronic
1150250113 17:63700300-63700322 GGGAGCGCGGAGCCGGGGCGGGG - Intronic
1150488923 17:65561362-65561384 GGTCGCGCCGAGCCGCGGCGTGG - Intronic
1152032441 17:77852831-77852853 GGCAGGGCAGAGCCGCGGCGTGG + Intergenic
1152745753 17:82037841-82037863 GGGCGCGCCGGGGCGGGGCGGGG + Intergenic
1154210814 18:12377281-12377303 GGTCGCGGCGGGCCTCGGAGAGG - Exonic
1157613942 18:48975981-48976003 GGAGGCGCCGGGCGGCGGCGAGG + Intergenic
1158718239 18:59899779-59899801 GGCGGCGCCGACCCGCGGCGGGG - Intergenic
1159798072 18:72867695-72867717 GGACGCCCCGAGCCGGGGCCGGG + Exonic
1159915255 18:74182566-74182588 GGTCCCGCGGAGCCCCTGCGAGG - Intergenic
1161027205 19:2042213-2042235 GGTGGGGCGGGGCCGCGGCGGGG - Intronic
1161333843 19:3700479-3700501 GGGCGCGCCGGGCCGGCGCGGGG + Exonic
1162808630 19:13151606-13151628 GGTCGCCCCTACCCGCTGCGGGG + Intronic
1165305418 19:35000246-35000268 GGCGGCGCCGTGACGCGGCGGGG + Intronic
1165721598 19:38082912-38082934 GGGCTCCCCGAGCAGCGGCGAGG + Exonic
1165859409 19:38899459-38899481 GGTCGGGCCGCGCCGGGGCCTGG - Intronic
928093432 2:28390468-28390490 GGGCGCGCCCAGCCCCGGCCAGG - Intergenic
929701916 2:44169358-44169380 GGTGCTGCCGAGCCGCGGCCGGG + Intronic
932456398 2:71852457-71852479 GGGGGCGCCGAGCTGAGGCGGGG - Intergenic
935149070 2:100417519-100417541 GGACCCGACGGGCCGCGGCGCGG - Exonic
942890516 2:180981083-180981105 GGTGTCCGCGAGCCGCGGCGGGG + Intronic
943645969 2:190408322-190408344 GGGCGCGGCGAGGCGAGGCGAGG - Intergenic
946329926 2:219003190-219003212 GGTGGAGGCGAGCCGCGGGGAGG - Exonic
1168757184 20:325805-325827 GGCCGGGCCGAGCCGCGGGGCGG + Exonic
1171769478 20:29311342-29311364 GGTCGAGGCGAGGCGGGGCGAGG - Intergenic
1171852249 20:30316938-30316960 GGGTGCGGGGAGCCGCGGCGAGG - Intergenic
1172974134 20:38893991-38894013 GGCCGCGCCGTGCTGCTGCGTGG + Intronic
1173454122 20:43189883-43189905 GTTCGCGCCGCGCCTCGGCTTGG - Exonic
1176221147 20:63969841-63969863 GGCCGGGCCGGGCCGGGGCGGGG + Intronic
1176549014 21:8213569-8213591 GGCCGCGCCGCGCCGCGCCGGGG + Intergenic
1176550314 21:8218009-8218031 GGTCGCGCCCGGCCGGCGCGCGG - Intergenic
1176556905 21:8257783-8257805 GGCCGCGCCGCGCCGCGCCGGGG + Intergenic
1176567943 21:8396601-8396623 GGCCGCGCCGCGCCGCGCCGGGG + Intergenic
1176569242 21:8401047-8401069 GGTCGCGCCCGGCCGGCGCGCGG - Intergenic
1176575847 21:8440820-8440842 GGCCGCGCCGCGCCGCGCCGGGG + Intergenic
1176577156 21:8445279-8445301 GGTCGCGCCCGGCCGGCGCGCGG - Intergenic
1180871413 22:19149225-19149247 GGTGGCGCGCAGCCGCGGCCCGG - Intronic
1181631892 22:24155973-24155995 GCTCGCGGCGGGCCGGGGCGGGG - Intronic
1183893659 22:40950975-40950997 GGGCTCGCCGAGTCGCCGCGCGG - Intergenic
1184557439 22:45240931-45240953 GGCCGGGCCGGGCCGGGGCGGGG - Intergenic
1184673358 22:46027379-46027401 GGCCGCGCCCCGCCGCGCCGGGG + Intergenic
1185397582 22:50600741-50600763 GGGCGGGCCGAGCGCCGGCGCGG + Exonic
1203253898 22_KI270733v1_random:129878-129900 GGCCGCGCCGCGCCGCGCCGGGG + Intergenic
1203255209 22_KI270733v1_random:134347-134369 GGTCGCGCCCGGCCGGCGCGCGG - Intergenic
1203261954 22_KI270733v1_random:174957-174979 GGCCGCGCCGCGCCGCGCCGGGG + Intergenic
1203263265 22_KI270733v1_random:179426-179448 GGTCGCGCCCGGCCGGCGCGCGG - Intergenic
950065488 3:10108329-10108351 GGGCAGCCCGAGCCGCGGCGGGG + Intergenic
950434067 3:12967936-12967958 GGCGGGGCCGAGCCGAGGCGCGG + Intronic
950633187 3:14297824-14297846 GGTCGGGCCAGGCTGCGGCGGGG - Intergenic
953908920 3:46882289-46882311 GGTGGCTCCGAGCGGCGGCCGGG + Intronic
954156138 3:48685869-48685891 GGGAGCGCCGAGCCGCGCCGCGG + Exonic
956604993 3:71065031-71065053 GGGCGCGGCGCGGCGCGGCGCGG - Intronic
961377357 3:126475764-126475786 GCTCGCGCCGAGCGGCGCTGGGG + Exonic
964720423 3:159763963-159763985 GGCCGGGCCGGGCCGGGGCGGGG + Intronic
968556309 4:1248085-1248107 GGCCGGCCCGAGCCGCTGCGCGG - Intronic
981550543 4:145937561-145937583 GGGCGCGCCGGGGCGCGGGGCGG - Intronic
983792241 4:171813059-171813081 GAGCGCGGCGAGCCGGGGCGCGG - Intronic
988796539 5:34657111-34657133 GTTCTCCCCGAGCTGCGGCGGGG - Intronic
992105581 5:73447406-73447428 GGCCGCGCCGTGCGGTGGCGGGG + Exonic
992487491 5:77210561-77210583 GGTCGAGCTGGGCGGCGGCGGGG + Intronic
1003049341 6:2765780-2765802 GGTCGCACCGCGCCGGGGAGCGG + Exonic
1003868678 6:10384859-10384881 GCGCGCGCCGGGCCGGGGCGCGG + Intergenic
1006369230 6:33633845-33633867 GGCCGGGCCGGGCCGGGGCGGGG + Intronic
1018628833 6:165805142-165805164 GGGCGCGCGGAGGGGCGGCGGGG + Intronic
1023810192 7:43906185-43906207 GGTTGCCCCGGGCCGCGGCGAGG + Intronic
1023972402 7:45000573-45000595 GGTCGGGGCGAGCCGCTGCCCGG - Intronic
1026776597 7:73234860-73234882 GGACGCGCCTGGCCGCGGTGTGG + Intergenic
1027017448 7:74788230-74788252 GGACGCGCCTGGCCGCGGTGTGG + Intronic
1027070574 7:75157702-75157724 GGACGCGCCTGGCCGCGGTGTGG - Intergenic
1033654360 7:143362803-143362825 CGGCGAGCCGAGCCGGGGCGGGG - Intergenic
1033654364 7:143362808-143362830 GGCCGCGGCGAGCCGAGCCGGGG - Intergenic
1035021846 7:155805076-155805098 GGGAGAGCGGAGCCGCGGCGCGG - Intronic
1037865640 8:22440720-22440742 GGCGGCGCGGAGCCGCTGCGAGG + Intergenic
1043147287 8:76674183-76674205 CGTCGCCCGGAGCCGGGGCGCGG - Intergenic
1046770470 8:118112093-118112115 GGGCGCGCCGAGGGGCCGCGGGG - Intergenic
1053001122 9:34577866-34577888 GAGCGCGCCGAGCAGCCGCGGGG + Intronic
1057259704 9:93576742-93576764 GGCGGGGCCGAGCGGCGGCGCGG + Exonic
1057773353 9:97985073-97985095 GCCCGCGCCGGTCCGCGGCGGGG - Intronic
1060855874 9:126914867-126914889 GGCCACGCCGAGCCGGGCCGGGG - Exonic
1061108903 9:128552899-128552921 GGCGGCGCCGAGCCTCGGCCCGG - Intronic
1203470298 Un_GL000220v1:113022-113044 GGCCGCGCCGCGCCGCGCCGGGG + Intergenic
1203471607 Un_GL000220v1:117484-117506 GGTCGCGCCCGGCCGGCGCGCGG - Intergenic
1203478119 Un_GL000220v1:156994-157016 GGCCGCGCCGCGCCGCGCCGGGG + Intergenic
1203479428 Un_GL000220v1:161456-161478 GGTCGCGCCCGGCCGGCGCGCGG - Intergenic