ID: 1150488924

View in Genome Browser
Species Human (GRCh38)
Location 17:65561367-65561389
Sequence GGCGAGGTCGCGCCGAGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 126}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150488924_1150488935 8 Left 1150488924 17:65561367-65561389 CCGCGGCTCGGCGCGACCTCGCC 0: 1
1: 0
2: 0
3: 8
4: 126
Right 1150488935 17:65561398-65561420 GAGGGGGGCTTTCTTTGAAGCGG 0: 1
1: 0
2: 1
3: 13
4: 153
1150488924_1150488927 -9 Left 1150488924 17:65561367-65561389 CCGCGGCTCGGCGCGACCTCGCC 0: 1
1: 0
2: 0
3: 8
4: 126
Right 1150488927 17:65561381-65561403 GACCTCGCCCCCTGTAAGAGGGG 0: 1
1: 0
2: 0
3: 3
4: 33
1150488924_1150488926 -10 Left 1150488924 17:65561367-65561389 CCGCGGCTCGGCGCGACCTCGCC 0: 1
1: 0
2: 0
3: 8
4: 126
Right 1150488926 17:65561380-65561402 CGACCTCGCCCCCTGTAAGAGGG 0: 1
1: 0
2: 0
3: 3
4: 32
1150488924_1150488938 19 Left 1150488924 17:65561367-65561389 CCGCGGCTCGGCGCGACCTCGCC 0: 1
1: 0
2: 0
3: 8
4: 126
Right 1150488938 17:65561409-65561431 TCTTTGAAGCGGCTCCGCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1150488924_1150488928 -8 Left 1150488924 17:65561367-65561389 CCGCGGCTCGGCGCGACCTCGCC 0: 1
1: 0
2: 0
3: 8
4: 126
Right 1150488928 17:65561382-65561404 ACCTCGCCCCCTGTAAGAGGGGG 0: 1
1: 0
2: 1
3: 2
4: 81
1150488924_1150488936 17 Left 1150488924 17:65561367-65561389 CCGCGGCTCGGCGCGACCTCGCC 0: 1
1: 0
2: 0
3: 8
4: 126
Right 1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 59
1150488924_1150488930 -7 Left 1150488924 17:65561367-65561389 CCGCGGCTCGGCGCGACCTCGCC 0: 1
1: 0
2: 0
3: 8
4: 126
Right 1150488930 17:65561383-65561405 CCTCGCCCCCTGTAAGAGGGGGG 0: 1
1: 0
2: 0
3: 3
4: 88
1150488924_1150488937 18 Left 1150488924 17:65561367-65561389 CCGCGGCTCGGCGCGACCTCGCC 0: 1
1: 0
2: 0
3: 8
4: 126
Right 1150488937 17:65561408-65561430 TTCTTTGAAGCGGCTCCGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150488924 Original CRISPR GGCGAGGTCGCGCCGAGCCG CGG (reversed) Intronic
900077258 1:827584-827606 GGCGGGGCCGGGCCGGGCCGGGG + Intergenic
900201292 1:1407785-1407807 GCAGAGGCCGCGGCGAGCCGAGG - Intergenic
900314676 1:2050803-2050825 GGCGAGGTCGCTGCGGGCCCGGG + Intronic
901434019 1:9235134-9235156 CCCGAGGCCGCGCCGAGCCCCGG + Intronic
901530514 1:9849718-9849740 GGCCAGGCCGCGCCCAGCAGAGG - Exonic
903251124 1:22053385-22053407 GGCGGGGTGGCCCCGAGCCACGG + Intronic
904190174 1:28737225-28737247 GGGCAGGCCGAGCCGAGCCGAGG + Intronic
905070852 1:35224080-35224102 GGCGAGGTTGCAGTGAGCCGGGG - Intergenic
906551348 1:46668505-46668527 GGCGAGAGCGCGCAGTGCCGGGG - Intronic
907051175 1:51330614-51330636 GGCGGGGCCGGGCCGAGCCTCGG + Intronic
907880375 1:58544660-58544682 GGCGAGGTTGCAGTGAGCCGAGG - Intronic
912765405 1:112404997-112405019 GCCGAGGTTGCGGTGAGCCGAGG + Intronic
914022828 1:143885099-143885121 CGCCAGGTGGCGCCGCGCCGGGG - Intergenic
914661315 1:149793043-149793065 CGCCAGGTGGCGCCGCGCCGGGG - Intronic
915161258 1:153922515-153922537 GGCGGGGGCGCGCCGTGCCGGGG + Intronic
917974352 1:180229761-180229783 GGCGGGGCGGAGCCGAGCCGGGG - Intergenic
920556759 1:206909782-206909804 AGCGCGGTCGCGGCGACCCGCGG + Exonic
1064109285 10:12523941-12523963 GCCGAGATCGCGCCAAGCCTGGG - Intronic
1065712812 10:28533453-28533475 GCCGAGGGCGCGCCGGGCCCAGG + Exonic
1066371038 10:34818254-34818276 GCCGAGGTTGCGGTGAGCCGAGG + Intergenic
1067079577 10:43205530-43205552 GGCGAGGGCACGCCCAGCCGAGG - Intronic
1072626413 10:97115216-97115238 GGCGAGGTCAAGCAGAGCCCAGG - Intronic
1074088404 10:110226064-110226086 GCGGAGAGCGCGCCGAGCCGCGG + Intronic
1075144456 10:119872142-119872164 GGGGAGGGCCCGCAGAGCCGCGG - Intronic
1076401884 10:130190265-130190287 GGCGAGGTCGGGCTGAAGCGCGG - Intergenic
1078210271 11:9264939-9264961 GGTGAGTGCGCGCCGAGCCCGGG - Exonic
1084151332 11:67289262-67289284 GGCGGGGCTGCGCCGGGCCGGGG - Intronic
1088028747 11:105219875-105219897 GCAGAGGTTGCGGCGAGCCGTGG + Intergenic
1091740757 12:2959244-2959266 GGCGGGGCCGGGCCGGGCCGGGG - Intergenic
1092154894 12:6275772-6275794 GCCGAGGTCGCAGTGAGCCGAGG + Intergenic
1092502915 12:9065435-9065457 AGCAAGGTCGGGCCGAGCCTGGG + Intergenic
1093435327 12:19129676-19129698 CGCGGGGGCGCGCCGGGCCGGGG + Intergenic
1095810680 12:46371511-46371533 GGCGGGGGCGCGCCGAGGGGCGG + Intronic
1096741254 12:53695656-53695678 GGCGAGGGCGCGCTGGGGCGGGG + Intergenic
1097823969 12:64155682-64155704 GCCGAGGTCGTGGTGAGCCGAGG - Exonic
1102512325 12:113424089-113424111 GGCGAGGTTGCGGTGAGGCGAGG - Intronic
1102846834 12:116194231-116194253 GTGGAGGTTGCGACGAGCCGAGG - Intronic
1102853847 12:116277186-116277208 GGCGAGGCCGGGCCGGGCGGCGG + Exonic
1105943409 13:25170693-25170715 GGCATCGGCGCGCCGAGCCGGGG - Exonic
1113695704 13:112343785-112343807 GGCGAGGACACGCCGCGCTGGGG - Intergenic
1121547573 14:94773033-94773055 GGGGAGGTCCCGCCGCGCAGGGG - Intergenic
1122220969 14:100239036-100239058 GGCGCGGGCGCACCGAGGCGAGG + Exonic
1122602580 14:102929012-102929034 GGCGGGGTCGGGCCGAGGTGGGG - Intronic
1122975382 14:105168719-105168741 AGCGCGGGCGCGCAGAGCCGAGG - Exonic
1124004661 15:25786115-25786137 GGCAAGGTCGTGCCCAGGCGGGG + Intronic
1125035809 15:35122159-35122181 GGCGGGTGCGCGCCGAGCCCCGG - Intergenic
1125678831 15:41517873-41517895 GGAGAGGTGGCACTGAGCCGAGG + Intronic
1127293667 15:57591862-57591884 GGCGGGGCCGGGCCGGGCCGGGG - Intergenic
1128841367 15:70853895-70853917 AGCGAGGAGGAGCCGAGCCGCGG - Exonic
1129082269 15:73052030-73052052 GGCGGGGGCGCGCGGAGCCGAGG + Intronic
1132572196 16:649046-649068 GGCGAGGTCGCGCTGAGGCCTGG - Intronic
1132657995 16:1049253-1049275 GGCAAGGCCGGGCCGATCCGGGG + Intergenic
1133021071 16:2967248-2967270 GGGCAGGGCGCGCCGAGCTGAGG - Intronic
1138530319 16:57631160-57631182 GGGGAGGTGGCGCCCAGTCGAGG + Intronic
1139557039 16:67719036-67719058 GGCGTGGACCCGCAGAGCCGGGG - Intronic
1139785009 16:69385744-69385766 GGCGGGGGCGCCACGAGCCGGGG - Exonic
1140462136 16:75148563-75148585 GGCGAAGACGCGCGGAGACGGGG - Exonic
1141184847 16:81779640-81779662 GGAGAGGTGGCGCCGGCCCGGGG - Intronic
1142141278 16:88473849-88473871 GGCGAGGCCGCGTGGGGCCGTGG - Intronic
1143784839 17:9248428-9248450 GCGGAGGTTGCGGCGAGCCGAGG - Intergenic
1145935250 17:28711375-28711397 GGCGGGCTCGCGTCGAGCCGCGG - Intronic
1148206721 17:45784222-45784244 GGCGAGGGGGCGGGGAGCCGAGG + Intergenic
1150267899 17:63842656-63842678 AGCGATGTCGGGCCGAGGCGCGG - Exonic
1150488924 17:65561367-65561389 GGCGAGGTCGCGCCGAGCCGCGG - Intronic
1151582390 17:74987825-74987847 GCCGGGGTCCCGCAGAGCCGGGG - Exonic
1151947807 17:77329095-77329117 GGCCAGGTCGTGCCGGGCCTTGG + Intronic
1152688584 17:81707283-81707305 GGCGAGGTCCCGCCCTCCCGTGG + Exonic
1153238768 18:3012875-3012897 GGCGCGGTCGCGGCGAGGCGGGG + Intronic
1157496754 18:48161949-48161971 GGCGGTGCCGCGCCGGGCCGCGG - Intronic
1159919244 18:74212916-74212938 GGCGAGGTTGCAGTGAGCCGAGG - Intergenic
1160674699 19:383788-383810 GCGGAGGTTGCGGCGAGCCGAGG - Intergenic
1161388067 19:4007529-4007551 GGCGTGGTCGCCGCGAGCGGGGG + Intergenic
1162954343 19:14090095-14090117 GGCGGGGTGGCTCCGCGCCGGGG + Exonic
1165495827 19:36151610-36151632 GCCGGGAGCGCGCCGAGCCGGGG - Intronic
1166838453 19:45681846-45681868 GGCGAGGTCCCCACCAGCCGCGG + Exonic
1168307334 19:55442694-55442716 GGCGGGGGCGCGGCGAGCCCAGG - Exonic
925079988 2:1056273-1056295 GGAGAGGCCGCGCCGTGCTGTGG + Intronic
925080000 2:1056308-1056330 GGAGAGGCCGCGCCGTGCTGTGG + Intronic
927751305 2:25673224-25673246 GGGGAGGGCGCGGGGAGCCGGGG - Intronic
928087250 2:28353438-28353460 GGCGAGGTTGCGGTGAGCTGAGG - Intergenic
929765971 2:44844281-44844303 GCCGAGATCGCGCCGTGCCTAGG - Intergenic
937093926 2:119223857-119223879 GCCGCGGTCGCTCCGAGCGGCGG + Exonic
944831186 2:203535193-203535215 GGCGAGGGAGCGCCGCGCCTGGG - Exonic
946909082 2:224442666-224442688 ACCGAGGACGCGCCGAGCCGAGG + Intergenic
947641636 2:231710453-231710475 GGCGAGAGCGGGCGGAGCCGGGG + Intronic
947860475 2:233354435-233354457 GCCGAGGGCGGGCCGGGCCGGGG - Intergenic
1169496780 20:6123075-6123097 GGCGAGGGCACGCCCAGCCCCGG + Exonic
1170590781 20:17770090-17770112 GCGGAGGTTGCACCGAGCCGAGG + Intergenic
1172474486 20:35226752-35226774 GGGGCGGCCGCGCCGCGCCGGGG + Exonic
1175358651 20:58389641-58389663 GGCGAGGCCGGGCCGGGCCTTGG + Intronic
1182546712 22:31081037-31081059 GGGGGGGGCGCCCCGAGCCGAGG - Intronic
1183294140 22:37019809-37019831 GGGGAGGGGGCGCCGCGCCGCGG + Intronic
1183586551 22:38756117-38756139 CGCGAGGGCGGGGCGAGCCGGGG - Intronic
1184640496 22:45867665-45867687 GAGGAGGGCGCGCCGGGCCGCGG - Intergenic
1185335938 22:50270886-50270908 GGGGAGGTCAGGGCGAGCCGGGG - Intergenic
950434067 3:12967936-12967958 GGCGGGGCCGAGCCGAGGCGCGG + Intronic
950610611 3:14124573-14124595 GGCGTGGTCGCGGGGCGCCGGGG + Intronic
954384288 3:50236270-50236292 GGCGGGGCCGAGCCGGGCCGTGG + Exonic
954975665 3:54692040-54692062 GGCGAGGTTGCAGTGAGCCGAGG - Intronic
961754860 3:129121683-129121705 GGCGGGGCCGAGCCGGGCCGGGG - Exonic
967867815 3:194204415-194204437 GGCCAGGTAGCGCCGCGGCGGGG - Intergenic
969436838 4:7193468-7193490 GGGGAGGTAACGCCGAGCTGGGG - Intronic
974069345 4:57110134-57110156 GGCGAGGGCGAGCCGTGCGGGGG - Exonic
976053066 4:81031157-81031179 GGCGAGGGCGCACGGAGCCCGGG - Exonic
979674651 4:123398278-123398300 GGCCCGGCCGCGCGGAGCCGCGG + Intronic
983792242 4:171813064-171813086 GGCGGGAGCGCGGCGAGCCGGGG - Intronic
991676598 5:69094433-69094455 GGAGAGGGCGCGCCGACCCCGGG - Intronic
992487488 5:77210556-77210578 GGCGAGGTCGAGCTGGGCGGCGG + Intronic
997980402 5:138464847-138464869 GGCGAGGGCGAGTCGGGCCGGGG - Intergenic
1001401894 5:171450950-171450972 GGCGAGGGCGGGCCGCGGCGTGG - Intronic
1003049339 6:2765775-2765797 GGCCGGGTCGCACCGCGCCGGGG + Exonic
1005348192 6:24910481-24910503 GGCGAGGAAGCGCCGGGCCCCGG - Intronic
1006369227 6:33633840-33633862 GGCGGGGCCGGGCCGGGCCGGGG + Intronic
1006860911 6:37170900-37170922 GGGGAGGGCGCGCCGGGCGGGGG + Intronic
1014205385 6:118651128-118651150 GGCGAGGTCCCGAGGCGCCGCGG + Intronic
1017324716 6:153131446-153131468 CGCGAGGTCGGGCGGGGCCGGGG - Intergenic
1026853477 7:73738645-73738667 GCCGAGGGGGCGCCGAGCCGAGG - Exonic
1028987006 7:97016986-97017008 GGCCAGGACGCCGCGAGCCGTGG + Intergenic
1029238700 7:99143681-99143703 GGCGAGGGGGCGCCGGGGCGCGG + Intronic
1029438138 7:100573812-100573834 GGCACGTTCGCGCCGCGCCGCGG - Intronic
1030682660 7:112450134-112450156 GGCGGGGGCGCGCCGAGGCAGGG + Intronic
1031927274 7:127650977-127650999 GGCGTGGTAGCGCGGACCCGTGG + Intergenic
1032184202 7:129709796-129709818 GCAGAGGTTGCGGCGAGCCGAGG - Intronic
1035022680 7:155808596-155808618 GCCGAGGCCGCGCGGAGCCCGGG - Intronic
1046929724 8:119829949-119829971 GCCGAGATCGCGCCGAACCTGGG - Intronic
1049406182 8:142452765-142452787 GGCGGGGTCGGGCCGACCGGGGG - Intronic
1049803521 8:144528856-144528878 GGCGCGGTCGCGGGGAGCCCGGG - Exonic
1051622659 9:19067754-19067776 GCGGAGGTTGCGGCGAGCCGAGG - Intronic
1052492896 9:29189450-29189472 GACGGGGTCGCGCCGGGCAGAGG + Intergenic
1058069715 9:100589468-100589490 GTGGAGGTCGCAGCGAGCCGAGG + Intergenic
1060537997 9:124406917-124406939 GCCGAGGTTGCACTGAGCCGAGG + Intronic
1060713025 9:125889739-125889761 GGCGGGGGCGCGCCGCGGCGGGG + Intronic
1193085858 X:77447621-77447643 GGCGCGCGCGGGCCGAGCCGGGG - Intergenic
1193925490 X:87478905-87478927 GCGGAGGTTGCGGCGAGCCGAGG + Intergenic
1197694954 X:129540502-129540524 GGGGAGGCCGCGCAGGGCCGGGG + Intronic