ID: 1150488924

View in Genome Browser
Species Human (GRCh38)
Location 17:65561367-65561389
Sequence GGCGAGGTCGCGCCGAGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 126}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150488924_1150488930 -7 Left 1150488924 17:65561367-65561389 CCGCGGCTCGGCGCGACCTCGCC 0: 1
1: 0
2: 0
3: 8
4: 126
Right 1150488930 17:65561383-65561405 CCTCGCCCCCTGTAAGAGGGGGG 0: 1
1: 0
2: 0
3: 3
4: 88
1150488924_1150488938 19 Left 1150488924 17:65561367-65561389 CCGCGGCTCGGCGCGACCTCGCC 0: 1
1: 0
2: 0
3: 8
4: 126
Right 1150488938 17:65561409-65561431 TCTTTGAAGCGGCTCCGCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1150488924_1150488935 8 Left 1150488924 17:65561367-65561389 CCGCGGCTCGGCGCGACCTCGCC 0: 1
1: 0
2: 0
3: 8
4: 126
Right 1150488935 17:65561398-65561420 GAGGGGGGCTTTCTTTGAAGCGG 0: 1
1: 0
2: 1
3: 13
4: 153
1150488924_1150488927 -9 Left 1150488924 17:65561367-65561389 CCGCGGCTCGGCGCGACCTCGCC 0: 1
1: 0
2: 0
3: 8
4: 126
Right 1150488927 17:65561381-65561403 GACCTCGCCCCCTGTAAGAGGGG 0: 1
1: 0
2: 0
3: 3
4: 33
1150488924_1150488937 18 Left 1150488924 17:65561367-65561389 CCGCGGCTCGGCGCGACCTCGCC 0: 1
1: 0
2: 0
3: 8
4: 126
Right 1150488937 17:65561408-65561430 TTCTTTGAAGCGGCTCCGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 36
1150488924_1150488936 17 Left 1150488924 17:65561367-65561389 CCGCGGCTCGGCGCGACCTCGCC 0: 1
1: 0
2: 0
3: 8
4: 126
Right 1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 59
1150488924_1150488928 -8 Left 1150488924 17:65561367-65561389 CCGCGGCTCGGCGCGACCTCGCC 0: 1
1: 0
2: 0
3: 8
4: 126
Right 1150488928 17:65561382-65561404 ACCTCGCCCCCTGTAAGAGGGGG 0: 1
1: 0
2: 1
3: 2
4: 81
1150488924_1150488926 -10 Left 1150488924 17:65561367-65561389 CCGCGGCTCGGCGCGACCTCGCC 0: 1
1: 0
2: 0
3: 8
4: 126
Right 1150488926 17:65561380-65561402 CGACCTCGCCCCCTGTAAGAGGG 0: 1
1: 0
2: 0
3: 3
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150488924 Original CRISPR GGCGAGGTCGCGCCGAGCCG CGG (reversed) Intronic