ID: 1150488929

View in Genome Browser
Species Human (GRCh38)
Location 17:65561383-65561405
Sequence CCCCCCTCTTACAGGGGGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 94}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150488929_1150488938 3 Left 1150488929 17:65561383-65561405 CCTCGCCCCCTGTAAGAGGGGGG 0: 1
1: 0
2: 0
3: 8
4: 94
Right 1150488938 17:65561409-65561431 TCTTTGAAGCGGCTCCGCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1150488929_1150488935 -8 Left 1150488929 17:65561383-65561405 CCTCGCCCCCTGTAAGAGGGGGG 0: 1
1: 0
2: 0
3: 8
4: 94
Right 1150488935 17:65561398-65561420 GAGGGGGGCTTTCTTTGAAGCGG 0: 1
1: 0
2: 1
3: 13
4: 153
1150488929_1150488937 2 Left 1150488929 17:65561383-65561405 CCTCGCCCCCTGTAAGAGGGGGG 0: 1
1: 0
2: 0
3: 8
4: 94
Right 1150488937 17:65561408-65561430 TTCTTTGAAGCGGCTCCGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 36
1150488929_1150488936 1 Left 1150488929 17:65561383-65561405 CCTCGCCCCCTGTAAGAGGGGGG 0: 1
1: 0
2: 0
3: 8
4: 94
Right 1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150488929 Original CRISPR CCCCCCTCTTACAGGGGGCG AGG (reversed) Intronic
901232798 1:7650570-7650592 CCTCCCTCTGCCAGGGGGCATGG - Intronic
902987890 1:20166480-20166502 CCCCACTCTCTCAGGGGACGAGG + Intronic
903231537 1:21925399-21925421 TCCCCCTCATACTGGGGGCTTGG - Intronic
903592330 1:24466626-24466648 ACCCCCTCTTACATGGTTCGTGG + Intronic
904342352 1:29845178-29845200 TCCCCCACTTACAGGTGGCCTGG + Intergenic
906355972 1:45106264-45106286 CCCACCTCCCAGAGGGGGCGGGG - Intronic
911725368 1:101236811-101236833 CCCCCAGCTGACAGAGGGCGTGG + Intergenic
914845403 1:151281298-151281320 TCCCCCGCCTCCAGGGGGCGTGG + Intronic
920655016 1:207868541-207868563 CCCCCCTTCTTCAGGGGGCGCGG - Intergenic
922620929 1:226987717-226987739 CTCCCTTCTTACAGGGAACGGGG - Intergenic
922822595 1:228494417-228494439 CCCCCCTCTTGAGGTGGGCGTGG + Exonic
1067722625 10:48740700-48740722 CCCCCATCTTTCAGGTGGCCTGG + Intronic
1070085177 10:73230145-73230167 CAGCCCTCTTACAGGGAGTGAGG - Intronic
1075088542 10:119430138-119430160 CCCCCAGCTTGCAGGGGGCTGGG + Intronic
1077358768 11:2130515-2130537 CCCCCCTGTTACATGGGGGGGGG + Intronic
1078341640 11:10501456-10501478 CCCTTCTCTTACAGGGAGCGCGG + Exonic
1083885871 11:65573287-65573309 GCCCACTATTCCAGGGGGCGGGG + Intronic
1094451282 12:30585402-30585424 CCCCTCTCTTACAGGTTGGGGGG - Intergenic
1105203042 13:18195222-18195244 ACCCCCTCTTAAAGGGGCCGCGG - Intergenic
1113879021 13:113612332-113612354 CCTCCCTCTGACAGGGCCCGGGG - Intronic
1118749481 14:68795637-68795659 TCCCCCTCTCCCCGGGGGCGCGG + Intronic
1119322864 14:73741913-73741935 CTCCCCTCTTGCTGGGGGTGAGG - Intronic
1119910632 14:78346325-78346347 CCCCACTCTTACCTGGGGCCTGG + Intronic
1123471939 15:20562179-20562201 CCCCTCTCTTAGAGTGGGTGGGG + Intergenic
1123667373 15:22618029-22618051 CCCCTCTCTTAGAGTGGGTGCGG - Intergenic
1123732242 15:23157170-23157192 CCCCTCTCTTAGAGTGGGTGGGG + Intergenic
1123750377 15:23354552-23354574 CCCCTCTCTTAGAGTGGGTGGGG + Intergenic
1124282747 15:28378468-28378490 CCCCTCTCTTAGAGTGGGTGGGG + Intergenic
1124321215 15:28712596-28712618 CCCCTCTCTTAGAGTGGGTGCGG - Intronic
1124481285 15:30082757-30082779 CCCCTCTCTTAGAGTGGGTGGGG + Intergenic
1124487740 15:30134853-30134875 CCCCTCTCTTAGAGTGGGTGGGG + Intergenic
1124522314 15:30414436-30414458 CCCCTCTCTTAGAGTGGGTGGGG - Intergenic
1124536350 15:30551782-30551804 CCCCTCTCTTAGAGTGGGTGGGG + Intergenic
1124542829 15:30603830-30603852 CCCCTCTCTTAGAGTGGGTGGGG + Intergenic
1124755789 15:32403468-32403490 CCCCTCTCTTAGAGTGGGTGGGG - Intergenic
1124762301 15:32455810-32455832 CCCCTCTCTTAGAGTGGGTGGGG - Intergenic
1124776330 15:32593260-32593282 CCCCTCTCTTAGAGTGGGTGGGG + Intergenic
1132434075 15:101782279-101782301 CCACTCTCTTAGAGTGGGCGGGG - Intergenic
1133988914 16:10689898-10689920 CCCGCCTCCTTCAGGGGGCTGGG + Intronic
1134322267 16:13174670-13174692 CCCTCCTCTCACATGGGGTGAGG + Intronic
1139824468 16:69746187-69746209 CCCAGCTCTTCCAGTGGGCGGGG - Intronic
1141844597 16:86598806-86598828 CTCCCCTCTGACCAGGGGCGAGG - Intergenic
1142298587 16:89243061-89243083 CCACGCCCTTCCAGGGGGCGGGG + Intergenic
1143448678 17:7023078-7023100 CCCCCGTCCTGCAGGGGCCGCGG - Exonic
1147819647 17:43234202-43234224 CCGCCCTTTCACAGAGGGCGTGG + Intergenic
1147820954 17:43241597-43241619 CGCCCCTTTCACAGAGGGCGTGG + Intergenic
1147821763 17:43246089-43246111 CCGCCCTTTCACAGAGGGCGTGG + Intergenic
1147822855 17:43252244-43252266 CCGCCCTTTCACAGAGGGCGTGG + Intergenic
1147825373 17:43267048-43267070 CCGCCCTTTCACAGAGGGCGTGG + Intergenic
1147826496 17:43273515-43273537 CCGCCCTTTCACAGAGGGCGTGG + Intergenic
1147827385 17:43278393-43278415 CCGCCCTTTCACAGAGGGCGTGG + Intergenic
1147828493 17:43284554-43284576 CCGCCCTTTCACAGAGGGCGTGG + Intergenic
1147829602 17:43290706-43290728 CCGCCCTTTCACAGAGGGCGTGG + Intergenic
1147830693 17:43296840-43296862 CCGCCCTTTCACAGAGGGCGTGG + Intergenic
1147831379 17:43300456-43300478 CCGCCCTTTCACAGAGGGCGTGG + Intergenic
1150004637 17:61462362-61462384 CCCCCATCTGTCTGGGGGCGCGG + Intronic
1150488929 17:65561383-65561405 CCCCCCTCTTACAGGGGGCGAGG - Intronic
1151301812 17:73232377-73232399 CCCGCCTCTTCCCGTGGGCGGGG - Intronic
1153284846 18:3448357-3448379 GCCCCCTCTAACGGGCGGCGGGG + Intronic
1154929040 18:20973167-20973189 CAACCCTCTTACACCGGGCGTGG - Intronic
1157662773 18:49460321-49460343 ACCCCCTCTGACAGGAGGCCGGG + Intronic
1160994459 19:1876257-1876279 GCCCCCCCTTAAAGGGGCCGCGG + Intergenic
1162535551 19:11261578-11261600 CCCCCCGCCAACTGGGGGCGAGG + Intronic
926199620 2:10784985-10785007 CCCGCCTCCTACAGGTGCCGTGG + Exonic
929568658 2:43006280-43006302 CCTCCCTCTGACAGGGCGGGGGG + Intergenic
930646235 2:53911592-53911614 CCCTGCTCTAACAGTGGGCGGGG - Intronic
934567574 2:95349093-95349115 CCTCCCTCTGACGGGGGGCGGGG - Intronic
938483730 2:131682414-131682436 ACCCCCTCTTAAAGGGACCGCGG - Intergenic
939618309 2:144386142-144386164 CCCCCCTCGAATAGGGGGCAGGG - Intergenic
942725295 2:178999858-178999880 CTCCCCTCTTACTTGGGGCAAGG + Intronic
944933600 2:204545435-204545457 CCCGGCTCTTAAAGGGGCCGCGG - Intergenic
1171130959 20:22652590-22652612 CCCTCCTCTTACATGTGGAGGGG + Intergenic
1176714917 21:10342783-10342805 ACCCCCTCTTAAAGGGGCCGCGG + Intergenic
1180603431 22:17037155-17037177 ACCCCCTCTTAAAGGGGCCGCGG - Intergenic
1181000906 22:19987325-19987347 CCCCCCAGAGACAGGGGGCGGGG + Intronic
1183298649 22:37047093-37047115 CCCCCATCTTACAGAGGGTGAGG - Intergenic
1183584256 22:38742936-38742958 CCCGCCTCCTACAGGGGCAGGGG + Intronic
1183619569 22:38964711-38964733 TCCCCCCCTTACAGGGGACCAGG + Intronic
1183640369 22:39089002-39089024 TCCCCCCCTTACAGGGGACCAGG + Intergenic
959849645 3:111071708-111071730 TCCCCCTCTTGCGTGGGGCGGGG + Intronic
961446659 3:126984272-126984294 CCCCTTTCTTTCAAGGGGCGTGG - Intergenic
964095133 3:152922549-152922571 TCCACCTCTTACAGAGGGGGAGG - Intergenic
968134115 3:196209295-196209317 CCTCCCTCATACAGGGGCCAGGG - Intronic
980088890 4:128420912-128420934 CCCCCCTTTTACTGGGGCAGAGG + Intergenic
994037880 5:95223505-95223527 CACCCCTCTTTAAGGGGGAGTGG + Intronic
995118426 5:108508245-108508267 CCTCCCTCTTACAGGGAGGCTGG - Intergenic
999364431 5:151012746-151012768 CCTCCCTCTTGCAGGGGATGGGG + Intergenic
1007794589 6:44337474-44337496 CCCACCCCTGACAGGGGCCGTGG + Intronic
1013232405 6:108169767-108169789 CCCCCCTCCCACAGGGCGGGAGG - Intronic
1019127666 6:169851764-169851786 CCTCCCTCTTACAGGGACCCTGG + Intergenic
1019840476 7:3437649-3437671 CCCACCTATTTCAGGGGGCAGGG + Intronic
1020962663 7:14825555-14825577 CCCTACTCTGACAGGAGGCGAGG + Intronic
1028561202 7:92178418-92178440 CCCACCACTTTGAGGGGGCGAGG + Intronic
1038693316 8:29782732-29782754 CTCCCCTCCTACATGAGGCGTGG - Intergenic
1045138847 8:99255828-99255850 CCTCCCTCTTACAGCTGGGGTGG - Intronic
1049180377 8:141219101-141219123 TCTCCCTCTAACAGGGGGCCGGG + Intronic
1057551901 9:96057266-96057288 CCCCACTCTCACAGGGGCAGGGG + Intergenic
1060221259 9:121765205-121765227 TCCCCCTCTTCCAGGGGGGCTGG + Intronic
1060522217 9:124300376-124300398 CCCCCGTGTTAATGGGGGCGTGG + Intronic
1195711485 X:107776424-107776446 CCCCCCTTTTTCTGGGGGGGGGG + Intronic
1197673372 X:129303194-129303216 CCCCTCTCTTACAGGATGTGAGG - Intergenic
1198370546 X:135985362-135985384 CGCCGCTCTTAAAGGGGCCGCGG - Intergenic
1200146075 X:153927048-153927070 CCCCCCTCATCCAGGGGTGGTGG + Intronic