ID: 1150488931

View in Genome Browser
Species Human (GRCh38)
Location 17:65561388-65561410
Sequence GAAAGCCCCCCTCTTACAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 74}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1150488931_1150488936 -4 Left 1150488931 17:65561388-65561410 CCCCCTGTAAGAGGGGGGCTTTC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 59
1150488931_1150488938 -2 Left 1150488931 17:65561388-65561410 CCCCCTGTAAGAGGGGGGCTTTC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1150488938 17:65561409-65561431 TCTTTGAAGCGGCTCCGCTGGGG 0: 1
1: 0
2: 0
3: 3
4: 50
1150488931_1150488937 -3 Left 1150488931 17:65561388-65561410 CCCCCTGTAAGAGGGGGGCTTTC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1150488937 17:65561408-65561430 TTCTTTGAAGCGGCTCCGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 36
1150488931_1150488942 29 Left 1150488931 17:65561388-65561410 CCCCCTGTAAGAGGGGGGCTTTC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1150488942 17:65561440-65561462 CCACCCCCACCTTTTACAGCAGG 0: 1
1: 0
2: 2
3: 20
4: 187
1150488931_1150488943 30 Left 1150488931 17:65561388-65561410 CCCCCTGTAAGAGGGGGGCTTTC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 1150488943 17:65561441-65561463 CACCCCCACCTTTTACAGCAGGG 0: 1
1: 0
2: 3
3: 16
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1150488931 Original CRISPR GAAAGCCCCCCTCTTACAGG GGG (reversed) Intronic
900884114 1:5403386-5403408 AAAAGCCCCCCACTCACATGAGG + Intergenic
902561933 1:17283039-17283061 GAAAGCCCTTCTCTTTCAAGTGG + Exonic
903138701 1:21325998-21326020 GAAAGCCCCCTTCCCACAGCCGG - Intronic
905044568 1:34985456-34985478 GGGCGCCCCCATCTTACAGGTGG + Intronic
917769977 1:178266995-178267017 GAAAGCCCAGCTCTTAGAGCTGG - Intronic
1064140403 10:12785393-12785415 CAAAGCATCCCTCTTGCAGGAGG + Intronic
1073600232 10:104839336-104839358 AAAAGCCCACCCCTTTCAGGTGG - Intronic
1077250604 11:1559052-1559074 GACGGCCCTCCTCCTACAGGGGG - Exonic
1077445859 11:2590522-2590544 GAGAGCCCTCATCTTCCAGGTGG + Intronic
1078042076 11:7875973-7875995 GAAATCCCCCCTCTTCTAGGAGG - Intergenic
1080566221 11:33511831-33511853 GAATACCCCCATTTTACAGGTGG - Intergenic
1082210756 11:49498482-49498504 GACAGCCACCATCCTACAGGAGG + Intergenic
1083256481 11:61499131-61499153 GAGAGCACCCCGCTTACAGAAGG - Intergenic
1084765513 11:71305702-71305724 GAAAGCCTTCCTCTTGGAGGTGG - Intergenic
1086638883 11:89126307-89126329 GACAGCCACCATCCTACAGGAGG - Intergenic
1089514692 11:119025065-119025087 GAAAGCCGCCCACTGTCAGGGGG + Exonic
1094473857 12:30826440-30826462 GAAAGCCCAGCTCTGAGAGGCGG + Intergenic
1094587565 12:31792103-31792125 GAAAGCCCCCCGCAAACAGCTGG - Exonic
1096795541 12:54075265-54075287 CAAAGCCCCCCTCTCAGAGATGG - Intergenic
1108294309 13:48997990-48998012 GAAAGCCTCCATCTTCAAGGAGG + Intronic
1108853892 13:54769681-54769703 GAAAGCCATCTTATTACAGGAGG - Intergenic
1109803129 13:67402941-67402963 GGAAGCCCCCGTATTATAGGAGG - Intergenic
1117072065 14:52066676-52066698 GCAACCTCACCTCTTACAGGGGG + Intronic
1120960117 14:90116759-90116781 GAAATCCCCAGTCTTACAAGGGG + Intronic
1126097916 15:45102210-45102232 GAAAGCAGCCCTCAAACAGGGGG + Intronic
1127905724 15:63374346-63374368 GAAAGCCCTCCTCCTCCAGGAGG + Intronic
1128221351 15:65970825-65970847 CAAAGCCCTCCTCTTAGAGATGG + Intronic
1129082602 15:73053103-73053125 GAATGTCCCACTCTTACAAGTGG - Intronic
1133030832 16:3010240-3010262 GTCAGCCCCCCTCGTACCGGAGG + Intergenic
1139350921 16:66334821-66334843 GAAAGACCCCCAATTACAGAGGG + Intergenic
1142278354 16:89134787-89134809 GCAAGCCCCCTGCTTAAAGGTGG + Intronic
1145254496 17:21315268-21315290 GTGAGCCCCCCTCTTACTTGGGG + Intergenic
1150245113 17:63668903-63668925 GAAAGCCCCTCTCTCCCAGGCGG - Intronic
1150488931 17:65561388-65561410 GAAAGCCCCCCTCTTACAGGGGG - Intronic
1151707611 17:75779111-75779133 GAAAGCCCCCCGCAAACAGCTGG - Exonic
1155057800 18:22200467-22200489 GAAAGGCCCCCACTTGCTGGGGG + Intronic
1157211035 18:45742157-45742179 AAAAGCCCCCTTCTTCCTGGAGG - Intronic
1162130068 19:8521022-8521044 GAAGGACCCCATCTTACAGGTGG - Exonic
1168691348 19:58379443-58379465 GAATGCCACCCACCTACAGGTGG - Intronic
926044064 2:9696776-9696798 GAATGCCCCCCTTTAAAAGGAGG - Intergenic
926591992 2:14750171-14750193 AAAAGCCTCCTTCTTAGAGGAGG - Intergenic
932415940 2:71574028-71574050 GAAAGCCCCTCTCCTCTAGGTGG + Intronic
934279093 2:91595630-91595652 TGAACCCCCCCTCTTAGAGGCGG - Intergenic
934677523 2:96260166-96260188 GAAAACCCACCTGTTACATGGGG - Intronic
937023599 2:118679883-118679905 GAGAGCCCCCCTCATGGAGGCGG + Intergenic
940113075 2:150176312-150176334 GAGAGCCACTCTCTTACATGGGG - Intergenic
1180675475 22:17583331-17583353 GAAAGTCCCCCTCTCACAAGAGG + Intronic
1181847812 22:25726696-25726718 GAAAACTCTCCTGTTACAGGGGG - Exonic
1183752256 22:39728203-39728225 GTCAGCCTCCCTCTTACAGATGG - Intergenic
953902282 3:46850106-46850128 GAAAGGCCCCCTCTTGAAGACGG + Intergenic
954436142 3:50497364-50497386 GAAAGCCCCCATCTTAGGTGAGG - Intronic
954785748 3:53091140-53091162 CAAAGTCCGCCTCTTGCAGGTGG + Exonic
955339736 3:58116247-58116269 GAAAGCCACCCCCTGACACGGGG + Intronic
957770677 3:84687882-84687904 CTCAGCCGCCCTCTTACAGGAGG + Intergenic
963530578 3:146469478-146469500 GAAAGCCGCCCCCTTACCCGTGG + Intronic
968314569 3:197712492-197712514 GAAAGCCCTCATCTTTCAGAGGG + Intronic
970490913 4:16572850-16572872 GAAAGGCCCCATCTGAGAGGAGG - Intronic
976089962 4:81446874-81446896 GAAAGCCCCCTTCTGAGAGTGGG - Intronic
994260061 5:97647148-97647170 GATAGCCCCACACTTACAGCTGG - Intergenic
1001635375 5:173206310-173206332 GAAAGCCCTCCTGCTCCAGGTGG + Intergenic
1012216946 6:96598537-96598559 GAAAGCCACCCCCTTAAAGAAGG - Intronic
1022860296 7:34360286-34360308 GAGAGCCTCCCTCCTGCAGGAGG + Intergenic
1026152792 7:67802523-67802545 GAATGCCCCCATTTTAAAGGTGG + Intergenic
1031299532 7:120047160-120047182 GCAAGCCCCCTGCTTAAAGGTGG - Intergenic
1033507869 7:142023889-142023911 GAAAGCCCACCTCTCTCAGAGGG - Intronic
1036681530 8:10877915-10877937 GAAATCCCCCCTTTTACAAATGG - Intergenic
1043585263 8:81761124-81761146 GAAAGACCTCCTAATACAGGGGG + Intergenic
1047002791 8:120589696-120589718 GAATGCCCCTCTCTTAGAAGAGG - Intronic
1049047978 8:140167859-140167881 GAAAGCATCCCTCTCACAGGAGG + Intronic
1049056728 8:140242816-140242838 GGAAGCTCCCCACCTACAGGAGG + Intronic
1053079325 9:35161733-35161755 GGAAGCCCCGCTCATGCAGGAGG + Intergenic
1056349839 9:85739277-85739299 GAAAGCTCCCATCTTGCAGATGG + Intronic
1056638515 9:88350583-88350605 GAAAGGCCACTTCTTACATGGGG + Intergenic
1061615189 9:131774655-131774677 GAAAGCCCTCATTTTACAGATGG + Intergenic
1190095700 X:47478527-47478549 GAAAGCCACCCTCTTAAATTTGG - Intronic
1190727056 X:53196690-53196712 GAAAGCCCACCTCTGCCTGGAGG - Exonic
1192553414 X:72071132-72071154 CAAAGCCCTGCTCTGACAGGCGG - Intergenic
1195711479 X:107776419-107776441 CAAAGCCCCCCTTTTTCTGGGGG + Intronic
1196786439 X:119425258-119425280 GAAAGCCCGCCTACCACAGGGGG + Intronic
1199672454 X:150158692-150158714 GAAACCCCACCTCATACTGGGGG + Intergenic
1200906266 Y:8485761-8485783 GACAGCCCCCCTCCTAGAGTTGG - Intergenic